Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Rattus norvegicus
Genetic Insert: ALK7
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10980615
Proper citation: RRID:Addgene_80885 Copy
Species: Rattus norvegicus
Genetic Insert: Vamp3
Vector Backbone Description: Backbone Marker:Zuchero lab; Backbone Size:4561; Vector Backbone:pBZ-167 AAV CMV promoter base vector; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36151203
Comments: Uribina...& Gupton; PMID: 29351997
Gow...& Lazzarini; PMID:1383235
Pan... & Musacchio; PMID: 28059702.
Please visit https://www.biorxiv.org/content/10.1101/2022.07.08.498895v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_190154 Copy
Species: Rattus norvegicus
Genetic Insert: Vamp3
Vector Backbone Description: Backbone Marker:Zuchero lab; Backbone Size:4561; Vector Backbone:pBZ-167 AAV CMV promoter base vector; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36151203
Comments: Vamp3-pHluorin was cloned from a construct kindly provided by Prof. Stephanie Gupton, from this paper: PMID: 29351997.
Please visit https://www.biorxiv.org/content/10.1101/2022.07.08.498895v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_190152 Copy
Species: Rattus norvegicus
Genetic Insert: Synaptophysin
Vector Backbone Description: Vector Backbone:pEF; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29754754
Proper citation: RRID:Addgene_188981 Copy
Species: Rattus norvegicus
Genetic Insert: Synapsin1a
Vector Backbone Description: Backbone Marker:Clontech, Palo Alto, California; Backbone Size:3998; Vector Backbone:pEGFP-C1 vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: F255Y and S304A mutations in Synapsin1a insert do not affect plasmid function.
Proper citation: RRID:Addgene_187896 Copy
Species: Rattus norvegicus
Genetic Insert: rat KIF5C
Vector Backbone Description: Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35504282
Proper citation: RRID:Addgene_188071 Copy
Species: Rattus norvegicus
Genetic Insert: rat KIF5C
Vector Backbone Description: Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35504282
Proper citation: RRID:Addgene_188072 Copy
Species: Rattus norvegicus
Genetic Insert: myosin 1b isoform b
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4752; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:10233157
Comments: The expression of the recombinant plasmid includes the addition of 18 amino acids (SGLRSRAQASNSDPRYPP) between GFP and Myo1b.
Proper citation: RRID:Addgene_187362 Copy
Species: Rattus norvegicus
Genetic Insert: myosin 1b isoform b
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4743; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29588377
Comments: The expression of the recombinant plasmid includes the addition of 18 amino acids (SGLRSRAQASNSDPRYPP) between Cherry and Myo1b.
Proper citation: RRID:Addgene_187366 Copy
Species: Rattus norvegicus
Genetic Insert: myosin 1b isoform b Tail domain
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4713; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26195670
Comments: PCR cloning at BglII-SalI DNA fragment was generated by PCR on rat Myo1b cDNA with 5' primer TTGGCCATCAAGACCTTACCTA and 3' primer CCTCACTTAAGGGACAGCGACTT
Proper citation: RRID:Addgene_187365 Copy
Species: Rattus norvegicus
Genetic Insert: myosin 1b isoform b IQTail domain
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4743; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:10233157
Comments: The expression of the recombinant plasmid includes the addition of 18 amino acids (SGLRSRAQASNSDPRYPP) between GFP and Myo1b. Cloning by deletion of the fragment EcoRV-EcoRV from the recombinant plasmid encoding GFP-Myo1b.
Proper citation: RRID:Addgene_187363 Copy
Species: Rattus norvegicus
Genetic Insert: Syntaxin 3
Vector Backbone Description: Vector Backbone:pTEV5; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35322233
Proper citation: RRID:Addgene_186685 Copy
Species: Rattus norvegicus
Genetic Insert: Glt1b
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Please note that mutations I521V and N538Y in Glt1b (reference AF451299) were found during Addgene's quality control. The depositor noted that these mutations do NOT affect plasmid function.
Proper citation: RRID:Addgene_98707 Copy
Species: Rattus norvegicus
Genetic Insert: Il22ra2
Vector Backbone Description: Backbone Size:7649; Vector Backbone:pLL3.7; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25585681
Comments: This plasmid was generated as part of the NIAAA-funded INIA consortium.
Proper citation: RRID:Addgene_99032 Copy
Species: Rattus norvegicus
Genetic Insert: p53
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5472; Vector Backbone:pCI-Neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9278438
Comments: Addgene's QC result finds an additional K318E mutation, which the depositor notes should have no functional consequence as it is away from the dimerization and DNA binding motifs
Proper citation: RRID:Addgene_99239 Copy
Species: Rattus norvegicus
Genetic Insert: Evf2
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16705037
Proper citation: RRID:Addgene_99478 Copy
Species: Rattus norvegicus
Genetic Insert: gRNA and GFP donor
Vector Backbone Description: Vector Backbone:pOC2; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35851300
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474730v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_183434 Copy
Species: Rattus norvegicus
Genetic Insert: gRNA and GFP donor
Vector Backbone Description: Vector Backbone:pOC2; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35851300
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474730v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_183429 Copy
Species: Rattus norvegicus
Genetic Insert: gRNA and Halo donor
Vector Backbone Description: Vector Backbone:pOC1; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35851300
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474730v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_183426 Copy
Species: Rattus norvegicus
Genetic Insert: p75NTR-mGFP
Vector Backbone Description: Backbone Size:7245; Vector Backbone:pCAG-IRES2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_182947 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.