Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: E. coli
Genetic Insert: a loxP-flanked β-geo preceding the tetracycline transactivator tTA
Vector Backbone Description: Backbone Size:5100; Vector Backbone:pCA-HZ2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20634890
Proper citation: RRID:Addgene_26083 Copy
Species: E. coli
Genetic Insert: a loxP-flanked β-geo preceding the tetracycline transactivator tTA
Vector Backbone Description: Backbone Size:12000; Vector Backbone:pROSA26-PA targeting vector; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20634890
Comments: 6bp deletion in Addgene sequence compared to author sequence. The discrepancy is in the vector before the BGH terminator and is not likely to affect function.
Proper citation: RRID:Addgene_26082 Copy
Species: Homo sapiens
Genetic Insert: ATF4
Vector Backbone Description: Backbone Marker:Dr. Hongbin Shu; Vector Backbone:pRK5-A20 (TNFAIP3); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19164757
Proper citation: RRID:Addgene_26118 Copy
Species: Homo sapiens
Genetic Insert: ATF4
Vector Backbone Description: Backbone Marker:Dr. Hongbin Shu; Vector Backbone:pRK5-A20 (TNFAIP3); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19164757
Proper citation: RRID:Addgene_26114 Copy
Vector Backbone Description: Backbone Marker:SGC Oxford; Backbone Size:7218; Vector Backbone:pNIC-CH; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: pET expression vector with C-terminal His6 tag. Includes sites for LIC cloning, and a “stuffer” fragment that includes the SacB gene, allowing negative selection on 5% sucrose. GenBank accession number: EF199843
Primers for LIC cloning:
Add the following 5’ extensions to the PCR primers:
Upstream: TTAAGAAGGAGATATACTATG (ATG-initiation codon)
Downstream: AATGGTGGTGATGATGGTGCGC
The purified PCR fragments are treated with T4 DNA polymerase and dGTP, then annealed to the treated vector. See supplemental document for more information.
Proper citation: RRID:Addgene_26117 Copy
Vector Backbone Description: Backbone Size:3845; Vector Backbone:pBTBXh-2; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20148414
Comments: There is an extra G in the middle of the alignment between Addgene's quality control sequence and the author's sequence. This discrepancy is in a non-coding region and does affect function.
Proper citation: RRID:Addgene_26078 Copy
Vector Backbone Description: Backbone Size:3889; Vector Backbone:pBTBXh-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20148414
Comments: There is an extra G in the middle of the alignment between Addgene's quality control sequence and the author's sequence. This discrepancy is in a non-coding region and does affect function.
Proper citation: RRID:Addgene_26077 Copy
Vector Backbone Description: Backbone Size:3691; Vector Backbone:pBTBXh-3; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:20148414
Comments: There is an extra G in the middle of the alignment between Addgene's quality control sequence and the author's sequence. This discrepancy is in a non-coding region and does affect function.
Proper citation: RRID:Addgene_26079 Copy
Species: Homo sapiens
Genetic Insert: NOXA N1
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19164757
Proper citation: RRID:Addgene_26112 Copy
Vector Backbone Description: Backbone Size:4922; Vector Backbone:pBMTBX-3; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:20148414
Proper citation: RRID:Addgene_26074 Copy
Vector Backbone Description: Backbone Size:5076; Vector Backbone:pBMTBX-2; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20148414
Proper citation: RRID:Addgene_26073 Copy
Species: Homo sapiens
Genetic Insert: HRAS-V12
Vector Backbone Description: Backbone Marker:Verma lab; Backbone Size:8753; Vector Backbone:pTomo; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19122659
Comments: From the paper: To construct pTomo H-RasV12, we amplified Flag-tagged H-RasV12 from pGEM H-RasV12 by PCR and inserted it into the BamHI site of the pTomo vector.
Proper citation: RRID:Addgene_26292 Copy
Species: Homo sapiens
Genetic Insert: pSUPER IKK beta
Vector Backbone Description: Backbone Size:3176; Vector Backbone:pSUPER; Vector Types:RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12692549
Proper citation: RRID:Addgene_26209 Copy
Species: Homo sapiens
Genetic Insert: I-kappa-B kinase epsilon K38A
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12692549
Proper citation: RRID:Addgene_26202 Copy
Genetic Insert: no insert
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:7072; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Comments: A cDNA or miRNA can be inserted downstream of the CMV promoter. There is an IRES with the red fluorescent protein downstream so the transduced cells will be red.
Proper citation: RRID:Addgene_26287 Copy
Species: Homo sapiens
Genetic Insert: I-kappa-B kinase epsilon
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12692549
Proper citation: RRID:Addgene_26201 Copy
Species: Mus musculus
Genetic Insert: mCD8::GFP
Vector Backbone Description: Backbone Size:8023; Vector Backbone:pJFRC-MUH; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20697123
Proper citation: RRID:Addgene_26219 Copy
Vector Backbone Description: Backbone Size:7831; Vector Backbone:pBDP; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20697123
Proper citation: RRID:Addgene_26213 Copy
Species: Mus musculus
Genetic Insert: mCD8::GFP
Vector Backbone Description: Backbone Size:10785; Vector Backbone:pJFRC-MUH; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20697123
Proper citation: RRID:Addgene_26215 Copy
Species: Homo sapiens
Genetic Insert: pSUPER TBK1
Vector Backbone Description: Backbone Size:3176; Vector Backbone:pSUPER; Vector Types:RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12692549
Proper citation: RRID:Addgene_26210 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
