Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: G-CSF
Vector Backbone Description: Vector Backbone:PP117; Vector Types:; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29311542
Proper citation: RRID:Addgene_104944 Copy
Genetic Insert: GFP, mCherry, and CFP
Vector Backbone Description: Vector Backbone:PP117; Vector Types:; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29311542
Proper citation: RRID:Addgene_104952 Copy
Species: Mus musculus
Genetic Insert: IgG1 heavy chain, IgG3 heavy chain
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4483; Vector Backbone:pFUSEss-CHIg-mG1 (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29875771
Proper citation: RRID:Addgene_105851 Copy
Species: Mus musculus
Genetic Insert: IgG1 heavy chain
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4474; Vector Backbone:pFUSEss-CHIg-mG1 (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29875771
Proper citation: RRID:Addgene_105852 Copy
Species: Mus musculus
Genetic Insert: IgG1 heavy chain, IgG3 heavy chain
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4483; Vector Backbone:pFUSEss-CHIg-mG1 (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29875771
Proper citation: RRID:Addgene_105850 Copy
Species: Mus musculus
Genetic Insert: IgG3 heavy chain
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4483; Vector Backbone:pFUSEss-CHIg-mG3 (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29875771
Proper citation: RRID:Addgene_105858 Copy
Species: Mus musculus
Genetic Insert: IgG1, IgG3
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4474; Vector Backbone:pFUSEss-CHIg-mG3 (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29875771
Proper citation: RRID:Addgene_105856 Copy
Species: Mus musculus
Genetic Insert: IgG1 heavy chain, IgG3 heavy chain
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4483; Vector Backbone:pFUSEss-CHIg-mG1 (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29875771
Proper citation: RRID:Addgene_105854 Copy
Species: Mus musculus
Genetic Insert: IgG3 heavy chain
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4483; Vector Backbone:pFUSEss-CHIg-mG3; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29875771
Proper citation: RRID:Addgene_105862 Copy
Species: Mus musculus
Genetic Insert: IgG3 F(ab')2
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4549; Vector Backbone:pFUSEss-CHIg-mG3 (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29875771
Proper citation: RRID:Addgene_105860 Copy
Species: Mus musculus
Genetic Insert: IgG1 heavy chain
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4474; Vector Backbone:pFUSEss-CHIg-mG1; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29875771
Proper citation: RRID:Addgene_105849 Copy
Species: synthetic
Genetic Insert: lox-EM7p-Zeo-lox cassette flanked by Tn5 outer element
Vector Backbone Description: Backbone Marker:Epicentre; Backbone Size:2000; Vector Backbone:pMOD
Defining Citation: PMID:15784610
Comments: Note that Bleomycin and Zeocin are the same antibiotic.
Proper citation: RRID:Addgene_27182 Copy
Species: M. smegmatis
Genetic Insert: P-rpoB
Vector Backbone Description: Backbone Size:5390; Vector Backbone:pDE43-MCZ; Vector Types:Bacterial Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:21075796
Proper citation: RRID:Addgene_27073 Copy
Genetic Insert: Green fluorescent protein
Vector Backbone Description: Vector Backbone:pPICZA; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:25386923
Proper citation: RRID:Addgene_61336 Copy
Genetic Insert: None
Vector Backbone Description: Vector Backbone:None; Vector Types:; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:26350500
Comments: Derived from Lajoie, et. al., Genomically recoded organisms expand biological functions, Science, 2013, with the following genomic modifications: ΔmutS:zeo, ΔtolC, Δbla:tolC, SerB-/ΔSerB
Proper citation: RRID:Addgene_68306 Copy
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:4871; Vector Backbone:pPICZalpha C; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:23410102
Comments: C-terminal tags are separated by stop codons. Depending on the LP2 primer used in SLIC, the desired C-terminal tag(s) can be fused to the target gene.
Use the one of the following linearization primers pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer:
LP1 forward vector primer:
SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3'
LP2 - select an LP2 primer below depending on which C-terminal tags you want to include fused to your gene of interest:
none SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3'
10His- SLIC Primer 5`GAGCATCATCATCATCACCAC 3'
StrepOne - SLIC Primer 5`AGCGCTTGGAGCCACCCGCAG 3'
S-Tag - SLIC Primer 5`AAAGAAACCGCTGCTGCTAAATTCG 3'
HPC4 - SLIC Primer 5`GAGGACCAGGTGGACCCCCGG 3'
Æ54CPD - SLIC Primer 5`GGCAGCGGCAAGATCCTGCAC 3'
Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected.
Proper citation: RRID:Addgene_55190 Copy
Species: Viruses (Polyomaviridae)
Genetic Insert: Full genome of BoPyV2a isolate S22
Vector Backbone Description: Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Viral clone; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:25568187
Comments: Genome can be liberated by digestion with SacII
Proper citation: RRID:Addgene_62356 Copy
Species: Viruses (Polyomaviridae)
Genetic Insert: Full genome of BoPyV3 isolate S22
Vector Backbone Description: Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Viral clone; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:25568187
Comments: Genome can be liberated by digestion with EcoRI
Proper citation: RRID:Addgene_62368 Copy
Species: Viruses (Polyomaviridae)
Genetic Insert: Full genome of BoPyV3 isolate S23
Vector Backbone Description: Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Viral clone; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:25568187
Comments: Genome can be liberated by digestion with EcoRI
Proper citation: RRID:Addgene_62369 Copy
Species: Other
Genetic Insert: loxp-DsRed-loxp-eGFP
Vector Backbone Description: Backbone Marker:Eric Campeau & Paul Kaufman (Addgene plasmid # 17294); Vector Backbone:pLenti CMV/TO Zeo DEST (644-1) ; Vector Types:Lentiviral; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:31649238
Comments: loxp-DsRed-loxp-eGFP was PCR amplified from pMSCV-loxp-DsRed-loxp-eGFP-Puro-WPRE (Addgene plasmid #32702) using primers containing Sal1 and Not1 restriction enzyme sites. The amplified PCR fragment was digested with Sal1 and Not1 and ligated into the pENTRA1 vector cut with Sal1 and Not1. The Gateway SystemTM (Invitrogen) was used to recombine the pENTR1A shuttle vector with pLenti CMV/TO Zeo DEST (644-1) (#17294, Addgene) generating lentiviral vector 1.
Proper citation: RRID:Addgene_141148 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
