Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

744,367 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Authority

Sort Ascending

Sort Descending

 Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
3CB1/cSprouty2
 
Resource Report
Resource Website 		RRID:Addgene_22096 Sprouty 2 Gallus gallus Ampicillin PMID:10498682 Partial chicken Sprouty2 cDNA clone was isolated from a chick embryonic brain cDNA library (Lambda Zap). The entire coding region and 3' UTR sequences are included. For antisense probe, linearize the plasmid with EcoRI and use T7 Polymerase. The transcript should be approximately 1.4kb. Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript SK; Vector Types:Bacterial; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:07:33 0
3ME6/mSprouty2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22097 Sprouty 2 Mus musculus Ampicillin PMID:10498682 mSprouty cDNA clone was isolated from a mouse E11 cDNA library (Clonetech). The entire coding region as well as 5' and 3' UTR sequences are included. For antisense probe, linearize the plasmid with SacII and use T3 Polymerase. The transcript should be approximately 1.5kb. Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KS; Vector Types:Bacterial; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:07:33 1
ATF4.18: mATF4 (CHOP11/cATF)-GST
 
Resource Report
Resource Website 		RRID:Addgene_22130 ATF4/CHOP11 Mus musculus Ampicillin record is incomplete on this issue but the preponderance of the evidence suggests that this was the immunogen used to produce the antiserum referred to as "CHOP 11 FL Backbone Marker:ATCC; Backbone Size:5000; Vector Backbone:pGEX-KG; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:07:33 0
shHIF2α(#2) (HIF2α-#2-pSUPER-retro-GFP/Neo)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22131 synthethic oligonucleotide Ampicillin PMID:17526729 shRNA oligo sequence - 5'-GATCCCCGACAAGGTCTGCAAAGGGTTTCAAGAGAACCCTTTGCAGACCTTGTCTTTTT Backbone Marker:OligoEngine; Backbone Size:7394; Vector Backbone:pSUPER_Retro-GFP/Neo; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin synthethic oligonucleotide encoding shRNA targeting human HIF2alpha mRNA Addgene 2026-10-31 02:07:33 3
mGbx2
 
Resource Report
Resource Website 		RRID:Addgene_22092 GBX2 Mus musculus Ampicillin The insert contains the full coding sequence and has been used to make RNA probes. For antisense probe linearize with HindIII and use T7 Polymerase. For sense probe linearize with ApaI or KpnI and transcribe with T3 RNA polymerase. Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Bacterial; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:07:33 0
mSprouty4 EST
 
Resource Report
Resource Website 		RRID:Addgene_22093 Sprouty 4 Mus musculus Ampicillin PMID:10498682 This is a 900bp partial mouse Sprouty4 cDNA EST. For antisense probe, linearize the plasmid with EcoRI and use T7 Polymerase. The transcript should be approximately 0.9kb. Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript SK; Vector Types:Bacterial; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:07:33 0
pWJPrP34
 
Resource Report
Resource Website 		RRID:Addgene_22107 PrP exon 3 EcoR1 fragment Mus musculus Ampicillin PMID:19709627 Backbone Size:2900; Vector Backbone:pBTIIKS(+); Vector Types:construction of targeting vector; Bacterial Resistance:Ampicillin Added a Cla1 site right before translation start and Eag1 downstream of translation stop site. Addgene 2026-10-31 02:07:33 0
AIRAP.1
 
Resource Report
Resource Website 		RRID:Addgene_22104 AIRAP Mus musculus Ampicillin Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluscript KS(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:07:33 0
pWJPrP31
 
Resource Report
Resource Website 		RRID:Addgene_22105 PrP exon 3 EcoR1 fragment Mus musculus Ampicillin PMID:19709627 Backbone Size:2900; Vector Backbone:pBTIIKS(+); Vector Types:construction of targeting vector; Bacterial Resistance:Ampicillin genomic EcoR1 fragment containing exon 3 of PrP Addgene 2026-10-31 02:07:33 0
pEB1030
 
Resource Report
Resource Website 		RRID:Addgene_22067 Ampicillin PMID:18924111 Backbone Size:3051; Vector Backbone:pUT18C; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:07:33 0
pRS2 (HIF2a-pRetro-Super)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22100 synthethic oligonucleotide Ampicillin PMID:14691554 Backbone Marker:NKI-AVL; Backbone Size:6349; Vector Backbone:pRetro-Super; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin synthethic oligonucleotide encoding shRNA targeting human HIF2a mRNA Addgene 2026-10-31 02:07:33 2
pRS9 (HIF2a-pRetro-Super)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22101 synthethic oligonucleotide Ampicillin PMID:14691554 Backbone Marker:NKI-AVL; Backbone Size:6349; Vector Backbone:pRetro-Super; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin synthethic oligonucleotide encoding shRNA targeting human HIF2a mRNA Addgene 2026-10-31 02:07:33 1
HA-p73α-pcDNA3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22102 tumor protein p73 Homo sapiens Ampicillin PMID:9296498 Backbone Marker:Invitrogen; Backbone Size:5352; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin wt cDNA Addgene 2026-10-31 02:07:33 8
pEB587
 
Resource Report
Resource Website 		RRID:Addgene_22065 Ampicillin PMID:18924111 Backbone Size:5061; Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:07:33 0
pMTIKA
 
Resource Report
Resource Website 		RRID:Addgene_22061 mCMV-TetOn expression cassette Ampicillin PMID:16352528 Backbone Size:2389; Vector Backbone:pBS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:07:33 0
pVETL-Cmcs-Flag-Ataxin3Q22-C14A
 
Resource Report
Resource Website 		RRID:Addgene_22119 Ataxin 3 Homo sapiens Ampicillin PMID:17693639 Backbone Size:5756; Vector Backbone:pVETL-Cmcs; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin C14A Addgene 2026-10-31 02:07:33 0
pGEX-6P1-Ataxin3Q22
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22117 Ataxin 3 Homo sapiens Ampicillin PMID:18599482 Backbone Marker:GE Healthcare; Backbone Size:4984; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:07:33 1
pWJPrP38
 
Resource Report
Resource Website 		RRID:Addgene_22110 PrP genomic vector with cloning sites Mus musculus Ampicillin PMID:19709627 Backbone Size:8000; Vector Backbone:pBTIIKS(+); Vector Types:construction of targeting vector; Bacterial Resistance:Ampicillin 2.2 Kb EcoR1 fragement isolated from pWJPrP34 and ligated into the corresponding site in pWJPrP32 Addgene 2026-10-31 02:07:33 0
pWJPrP43
 
Resource Report
Resource Website 		RRID:Addgene_22112 PrP ki-3F4-FFI TC Mus musculus Ampicillin PMID:19709627 Backbone Size:2900; Vector Backbone:pBTIIKS(+); Vector Types:Mouse Targeting, construction of targeting vector; Bacterial Resistance:Ampicillin 3F4 epitope and FFI related D177N mutation Addgene 2026-10-31 02:07:33 0
pGEX-6P1-Ataxin3Q22-C14A
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22113 Ataxin 3 Homo sapiens Ampicillin PMID:18599482 Backbone Marker:GE Healthcare; Backbone Size:4984; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin C14A Addgene 2026-10-31 02:07:33 1

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

Join the NIDDK-CR Webinar "Pixels to Phenotypes – Whole Slide Imaging Pathomics” on October 28, 2026

dkNET Webinar: Gene Regulatory Network Analysis in Texera

dkNET Webinar: A Hormone Cell Atlas Maps the Human Endocrine System at Cellular Resolution

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch