Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Gallus gallus
Genetic Insert: Sprouty 2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript SK; Vector Types:Bacterial; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10498682
Comments: Partial chicken Sprouty2 cDNA clone was isolated from a chick embryonic brain cDNA library (Lambda Zap). The entire coding region and 3' UTR sequences are included.
For antisense probe, linearize the plasmid with EcoRI and use T7 Polymerase. The transcript should be approximately 1.4kb.
Proper citation: RRID:Addgene_22096 Copy
Species: Mus musculus
Genetic Insert: Sprouty 2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KS; Vector Types:Bacterial; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10498682
Comments: mSprouty cDNA clone was isolated from a mouse E11 cDNA library (Clonetech). The entire coding region as well as 5' and 3' UTR sequences are included.
For antisense probe, linearize the plasmid with SacII and use T3 Polymerase. The transcript should be approximately 1.5kb.
Proper citation: RRID:Addgene_22097 Copy
Species: Mus musculus
Genetic Insert: ATF4/CHOP11
Vector Backbone Description: Backbone Marker:ATCC; Backbone Size:5000; Vector Backbone:pGEX-KG; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: record is incomplete on this issue but the preponderance of the evidence suggests that this was the immunogen used to produce the antiserum referred to as "CHOP 11 FL
Proper citation: RRID:Addgene_22130 Copy
Genetic Insert: synthethic oligonucleotide
Vector Backbone Description: Backbone Marker:OligoEngine; Backbone Size:7394; Vector Backbone:pSUPER_Retro-GFP/Neo; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17526729
Comments: shRNA oligo sequence - 5'-GATCCCCGACAAGGTCTGCAAAGGGTTTCAAGAGAACCCTTTGCAGACCTTGTCTTTTT
Proper citation: RRID:Addgene_22131 Copy
Species: Mus musculus
Genetic Insert: GBX2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Bacterial; Bacterial Resistance:Ampicillin
Comments: The insert contains the full coding sequence and has been used to make RNA probes.
For antisense probe linearize with HindIII and use T7 Polymerase. For sense probe linearize with ApaI or KpnI and transcribe with T3 RNA polymerase.
Proper citation: RRID:Addgene_22092 Copy
Species: Mus musculus
Genetic Insert: Sprouty 4
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript SK; Vector Types:Bacterial; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10498682
Comments: This is a 900bp partial mouse Sprouty4 cDNA EST.
For antisense probe, linearize the plasmid with EcoRI and use T7 Polymerase. The transcript should be approximately 0.9kb.
Proper citation: RRID:Addgene_22093 Copy
Species: Mus musculus
Genetic Insert: PrP exon 3 EcoR1 fragment
Vector Backbone Description: Backbone Size:2900; Vector Backbone:pBTIIKS(+); Vector Types:construction of targeting vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19709627
Proper citation: RRID:Addgene_22107 Copy
Species: Mus musculus
Genetic Insert: AIRAP
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluscript KS(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_22104 Copy
Species: Mus musculus
Genetic Insert: PrP exon 3 EcoR1 fragment
Vector Backbone Description: Backbone Size:2900; Vector Backbone:pBTIIKS(+); Vector Types:construction of targeting vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19709627
Proper citation: RRID:Addgene_22105 Copy
Vector Backbone Description: Backbone Size:3051; Vector Backbone:pUT18C; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18924111
Proper citation: RRID:Addgene_22067 Copy
Genetic Insert: synthethic oligonucleotide
Vector Backbone Description: Backbone Marker:NKI-AVL; Backbone Size:6349; Vector Backbone:pRetro-Super; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14691554
Proper citation: RRID:Addgene_22100 Copy
Genetic Insert: synthethic oligonucleotide
Vector Backbone Description: Backbone Marker:NKI-AVL; Backbone Size:6349; Vector Backbone:pRetro-Super; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14691554
Proper citation: RRID:Addgene_22101 Copy
Species: Homo sapiens
Genetic Insert: tumor protein p73
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5352; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9296498
Proper citation: RRID:Addgene_22102 Copy
Vector Backbone Description: Backbone Size:5061; Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18924111
Proper citation: RRID:Addgene_22065 Copy
Genetic Insert: mCMV-TetOn expression cassette
Vector Backbone Description: Backbone Size:2389; Vector Backbone:pBS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16352528
Proper citation: RRID:Addgene_22061 Copy
Species: Homo sapiens
Genetic Insert: Ataxin 3
Vector Backbone Description: Backbone Size:5756; Vector Backbone:pVETL-Cmcs; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17693639
Proper citation: RRID:Addgene_22119 Copy
Species: Homo sapiens
Genetic Insert: Ataxin 3
Vector Backbone Description: Backbone Marker:GE Healthcare; Backbone Size:4984; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18599482
Proper citation: RRID:Addgene_22117 Copy
Species: Mus musculus
Genetic Insert: PrP genomic vector with cloning sites
Vector Backbone Description: Backbone Size:8000; Vector Backbone:pBTIIKS(+); Vector Types:construction of targeting vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19709627
Proper citation: RRID:Addgene_22110 Copy
Species: Mus musculus
Genetic Insert: PrP ki-3F4-FFI TC
Vector Backbone Description: Backbone Size:2900; Vector Backbone:pBTIIKS(+); Vector Types:Mouse Targeting, construction of targeting vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19709627
Proper citation: RRID:Addgene_22112 Copy
Species: Homo sapiens
Genetic Insert: Ataxin 3
Vector Backbone Description: Backbone Marker:GE Healthcare; Backbone Size:4984; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18599482
Proper citation: RRID:Addgene_22113 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
