Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: U6 miR-20 perfect
Vector Backbone Description: Backbone Size:5000; Vector Backbone:U6+27; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17694064
Comments: miR-20 perfect CMV sponge and U6 sponge, 2 sites:
CUACCUGCACUAUAAGCACUUUA
Proper citation: RRID:Addgene_21978 Copy
Genetic Insert: U6 miR-20 sponge
Vector Backbone Description: Backbone Size:5000; Vector Backbone:U6+27; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17694064
Proper citation: RRID:Addgene_21977 Copy
Genetic Insert: U6 miR-16 perfect
Vector Backbone Description: Backbone Size:5000; Vector Backbone:U6+27; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17694064
Comments: miR-16 perfect CMV sponge and U6 sponge:
CGCCAUAUUUACGUGCUGCUA
Proper citation: RRID:Addgene_21976 Copy
Genetic Insert: U6 miR-16 sponge
Vector Backbone Description: Backbone Size:5000; Vector Backbone:U6+27; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17694064
Comments: mir-16 bulged Renilla luciferase reporter, CMV sponge, and U6 sponge, 9 sites
AAUAUUCUAUGCUGCUA
Proper citation: RRID:Addgene_21975 Copy
Species: Homo sapiens
Genetic Insert: PA-Rac1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:6000; Vector Backbone:pTriEx; Vector Types:Mammalian Expression, Bacterial Expression, Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19693014
Comments: Protocols for production and use of Hahn lab biosensors and photoactivatable proteins can be found on their web page, at the URL below. If you have suggestions for the protocols or have any questions, please feel free to contact the Hahn lab. Good luck with your experiments!
Hahn lab biosensor protocol: http://www.hahnlab.com/tools/index.html
Please note, Addgene has not confirmed all the mutations associated with this construct. We suggest sequence verifying this plasmid upon receipt.
Proper citation: RRID:Addgene_22027 Copy
Species: Homo sapiens
Genetic Insert: mVenus-PA-Rac1-C450A
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pBabe-TetCMV-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19693014
Comments: Protocols for production and use of Hahn lab biosensors and photoactivatable proteins can be found on their web page, at the URL below. If you have suggestions for the protocols or have any questions, please feel free to contact the Hahn lab. Good luck with your experiments!
Hahn lab biosensor protocol: http://www.hahnlab.com/tools/index.html
Please note, Addgene has not confirmed all the mutations associated with this construct. We suggest sequence verifying this plasmid upon receipt.
Proper citation: RRID:Addgene_22023 Copy
Species: Homo sapiens
Genetic Insert: PA-Rac1-C450A
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:6000; Vector Backbone:pTriEx; Vector Types:Mammalian Expression, Bacterial Expression, Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19693014
Comments: Protocols for production and use of Hahn lab biosensors and photoactivatable proteins can be found on their web page, at the URL below. If you have suggestions for the protocols or have any questions, please feel free to contact the Hahn lab. Good luck with your experiments!
Hahn lab biosensor protocol: http://www.hahnlab.com/tools/index.html
Please note, Addgene has not confirmed all the mutations associated with this construct. We suggest sequence verifying this plasmid upon receipt.
Proper citation: RRID:Addgene_22021 Copy
Genetic Insert: hCMV promoter expression cassette
Vector Backbone Description: Backbone Size:6700; Vector Backbone:pAL; Vector Types:Adenoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15564139
Proper citation: RRID:Addgene_21909 Copy
Species: Mus musculus
Genetic Insert: Oct4i
Vector Backbone Description: Backbone Size:7558; Vector Backbone:pSicoR; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19587682
Comments: Oct4 RNAi sequence 5'-GAACCTGGCTAAGCTTCCA
Proper citation: RRID:Addgene_21906 Copy
Species: Mus musculus
Genetic Insert: CHOP
Vector Backbone Description: Backbone Size:4767; Vector Backbone:pcDNA1.1/Amp; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: 9E10 (Myc-epitope) tagged mouse CHOP coding region only, S78A and S81A double mutant. The S78A and S81A mutation introduces an additional HhaI site not present in the wildtype insert. Note that there is considerable uncertainity regarding this plasmid.
Proper citation: RRID:Addgene_21902 Copy
Species: Homo sapiens
Genetic Insert: NFkB p65 subunit
Vector Backbone Description: Backbone Marker:Matthias P et al. Nucleic Acids Research (1989). 17(15): 6418; Backbone Size:5120; Vector Backbone:pEv3s; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11533489
Proper citation: RRID:Addgene_21984 Copy
Species: Homo sapiens
Genetic Insert: Ataxin 3
Vector Backbone Description: Backbone Marker:Sigma; Backbone Size:4700; Vector Backbone:pFLAG-CMV-6a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_22128 Copy
Species: Homo sapiens
Genetic Insert: Ataxin 3
Vector Backbone Description: Backbone Size:5756; Vector Backbone:pVETL-Cmcs; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17693639
Proper citation: RRID:Addgene_22121 Copy
Species: Gallus gallus
Genetic Insert: FGF8
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript SK (-); Vector Types:Bacterial; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8548816
Comments: Chick homolog of mouse FGF8 splice variant 1 clone was isolated from an E10 chick brain cDNA library directionally cloned into lambdaZapII. The insert contains most of the coding region.
For antisense probe linearize with EcoRI and use T7 Polymerase.
Proper citation: RRID:Addgene_22089 Copy
Species: Mus musculus
Genetic Insert: FGF2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Bacterial; Bacterial Resistance:Ampicillin
Comments: Full length coding region, PCR clone. The insert can be cut out with EcoRI and XbaI.
Proper citation: RRID:Addgene_22084 Copy
Species: Mus musculus
Genetic Insert: FGF3
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Bacterial; Bacterial Resistance:Ampicillin
Comments: cDNA with longest 5' end; poly A tail lost because cut with EcoRI.
Proper citation: RRID:Addgene_22086 Copy
Species: Danio rerio
Genetic Insert: pBS119d10L
Vector Backbone Description: Backbone Marker:Strategene; Backbone Size:3000; Vector Backbone:pBluescript II KS; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12167406
Comments: To view partial vector sequence from the depositing lab, please click on the Reviews link.
Proper citation: RRID:Addgene_22081 Copy
Species: Homo sapiens
Genetic Insert: Hypoxia inducible factor 2 alpha
Vector Backbone Description: Backbone Size:5573; Vector Backbone:pBabe-Hygro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14691554
Proper citation: RRID:Addgene_22134 Copy
Species: Homo sapiens
Genetic Insert: Hypoxia inducible factor 2 alpha
Vector Backbone Description: Backbone Size:5188; Vector Backbone:pBabe-Puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14691554
Proper citation: RRID:Addgene_22135 Copy
Species: Gallus gallus
Genetic Insert: Sprouty 1
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript II KS; Vector Types:Bacterial; Bacterial Resistance:Ampicillin
Comments: The partial clone contains ~230bp coding region and 3' UTR sequences.
For antisense probe, linearize the plasmid with XbaI and use T3 Polymerase. For negative control sense probe linearize with XhoI and transcribe with T7 Polymerase.
Proper citation: RRID:Addgene_22095 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
