Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 291 showing 5801 ~ 5820 out of 740,584 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_68664

http://www.addgene.org/68664

Vector Backbone Description: Backbone Marker:Kohchi Lab., Kyoto University; Backbone Size:10455; Vector Backbone:pMpGWB300; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Spectinomycin
Defining Citation: PMID:26406247

Proper citation: RRID:Addgene_68664 Copy   


  • RRID:Addgene_68663

http://www.addgene.org/68663

Vector Backbone Description: Backbone Marker:Kohchi Lab., Kyoto University; Backbone Size:10455; Vector Backbone:pMpGWB300; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Spectinomycin
Defining Citation: PMID:26406247

Proper citation: RRID:Addgene_68663 Copy   


http://www.addgene.org/68717

Species: Rattus norvegicus
Genetic Insert: mRuby2-P2A-GCaMP6s
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27284193
Comments: mRuby2: Article: Improving FRET dynamic range with bright green and red fluorescent proteins. Lam et al (Nat Methods. 2012 Sep 9. doi: 10.1038/nmeth.2171. PubMed) Addgene Plasmid 40260 GCaMP6s: Article: Ultrasensitive fluorescent proteins for imaging neuronal activity. Chen et al (Nature. 2013 Jul 18;499(7458):295-300. doi: 10.1038/nature12354. PubMed) Addgene Plasmid 40753

Proper citation: RRID:Addgene_68717 Copy   


  • RRID:Addgene_68716

    This resource has 10+ mentions.

http://www.addgene.org/68716

Species: Bacillus cereus
Genetic Insert: bsr
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26116467
Comments: Overall this plasmid contains bsr-GFP11-ires-puromycin resistance gene. GFP11 covers the 11th strand of GFP and the sequence is ctgcagcgcgatcacatggtcctgcacgagtacgtgaacgccgccgggatcact.

Proper citation: RRID:Addgene_68716 Copy   


  • RRID:Addgene_68671

http://www.addgene.org/68671

Vector Backbone Description: Backbone Marker:Kohchi Lab., Kyoto University; Backbone Size:9287; Vector Backbone:pMpGWB400; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Spectinomycin
Defining Citation: PMID:26406247

Proper citation: RRID:Addgene_68671 Copy   


  • RRID:Addgene_68670

http://www.addgene.org/68670

Vector Backbone Description: Backbone Marker:Kohchi Lab., Kyoto University; Backbone Size:9287; Vector Backbone:pMpGWB400; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Spectinomycin
Defining Citation: PMID:26406247

Proper citation: RRID:Addgene_68670 Copy   


http://www.addgene.org/68713

Species: Homo sapiens
Genetic Insert: H2B mCherry and TAZ/WWTR1
Vector Backbone Description: Vector Backbone:pLL3.7; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_68713 Copy   


  • RRID:Addgene_68679

http://www.addgene.org/68679

Vector Backbone Description: Backbone Marker:Kohchi Lab., Kyoto University; Backbone Size:9287; Vector Backbone:pMpGWB400; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Spectinomycin
Defining Citation: PMID:26406247

Proper citation: RRID:Addgene_68679 Copy   


  • RRID:Addgene_68675

http://www.addgene.org/68675

Vector Backbone Description: Backbone Marker:Kohchi Lab., Kyoto University; Backbone Size:9287; Vector Backbone:pMpGWB400; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Spectinomycin
Defining Citation: PMID:26406247

Proper citation: RRID:Addgene_68675 Copy   


  • RRID:Addgene_68673

http://www.addgene.org/68673

Vector Backbone Description: Backbone Marker:Kohchi Lab., Kyoto University; Backbone Size:9287; Vector Backbone:pMpGWB400; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Spectinomycin
Defining Citation: PMID:26406247

Proper citation: RRID:Addgene_68673 Copy   


  • RRID:Addgene_68726

http://www.addgene.org/68726

Species: Homo sapiens
Genetic Insert: FKBP12-rapamycin binding (FRB) domain of MTOR
Vector Backbone Description: Backbone Marker:Amersham Pharmacia Biotech; Vector Backbone:pGEX-2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9933627

Proper citation: RRID:Addgene_68726 Copy   


  • RRID:Addgene_68682

http://www.addgene.org/68682

Vector Backbone Description: Backbone Marker:Kohchi Lab., Kyoto University; Backbone Size:9287; Vector Backbone:pMpGWB400; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Spectinomycin
Defining Citation: PMID:26406247

Proper citation: RRID:Addgene_68682 Copy   


  • RRID:Addgene_68688

http://www.addgene.org/68688

Vector Backbone Description: Backbone Marker:Kohchi Lab., Kyoto University; Backbone Size:9287; Vector Backbone:pMpGWB400; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Spectinomycin
Defining Citation: PMID:26406247

Proper citation: RRID:Addgene_68688 Copy   


  • RRID:Addgene_68687

http://www.addgene.org/68687

Vector Backbone Description: Backbone Marker:Kohchi Lab., Kyoto University; Backbone Size:9287; Vector Backbone:pMpGWB400; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Spectinomycin
Defining Citation: PMID:26406247

Proper citation: RRID:Addgene_68687 Copy   


http://www.addgene.org/68720

Species: Rattus norvegicus
Genetic Insert: mRuby2-P2A-GCaMP6s
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27284193
Comments: mRuby2: Article: Improving FRET dynamic range with bright green and red fluorescent proteins. Lam et al (Nat Methods. 2012 Sep 9. doi: 10.1038/nmeth.2171. PubMed) Addgene Plasmid 40260 GCaMP6s: Article: Ultrasensitive fluorescent proteins for imaging neuronal activity. Chen et al (Nature. 2013 Jul 18;499(7458):295-300. doi: 10.1038/nature12354. PubMed) Addgene Plasmid 40753

Proper citation: RRID:Addgene_68720 Copy   


  • RRID:Addgene_68686

http://www.addgene.org/68686

Vector Backbone Description: Backbone Marker:Kohchi Lab., Kyoto University; Backbone Size:9287; Vector Backbone:pMpGWB400; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Spectinomycin
Defining Citation: PMID:26406247

Proper citation: RRID:Addgene_68686 Copy   


  • RRID:Addgene_68685

http://www.addgene.org/68685

Vector Backbone Description: Backbone Marker:Kohchi Lab., Kyoto University; Backbone Size:9287; Vector Backbone:pMpGWB400; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Spectinomycin
Defining Citation: PMID:26406247

Proper citation: RRID:Addgene_68685 Copy   


  • RRID:Addgene_68684

http://www.addgene.org/68684

Vector Backbone Description: Backbone Marker:Kohchi Lab., Kyoto University; Backbone Size:9287; Vector Backbone:pMpGWB400; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Spectinomycin
Defining Citation: PMID:26406247

Proper citation: RRID:Addgene_68684 Copy   


  • RRID:Addgene_68619

http://www.addgene.org/68619

Vector Backbone Description: Backbone Marker:Kohchi Lab., Kyoto University; Backbone Size:9021; Vector Backbone:pMpGWB200; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Spectinomycin
Defining Citation: PMID:26406247

Proper citation: RRID:Addgene_68619 Copy   


  • RRID:Addgene_68618

http://www.addgene.org/68618

Vector Backbone Description: Backbone Marker:Kohchi Lab., Kyoto University; Backbone Size:9021; Vector Backbone:pMpGWB200; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Spectinomycin
Defining Citation: PMID:26406247

Proper citation: RRID:Addgene_68618 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X