Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
|||||
|---|---|---|---|---|---|---|---|---|---|---|---|
|
pGL2 p15 4xSBR1 MutSBE Resource Report Resource Website |
RRID:Addgene_15718 | p15 4xSBR1 | Homo sapiens | Ampicillin | PMID:16959612 | SBR1 is one of the Smad Binding Regions on the p15INK4b promoter. Smad binding element sequence - ACTAATTCGGGCAGAAAGACACATCCAAGAGAA | Backbone Size:5600; Vector Backbone:pGL2-E1bTATA; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | Mutant SBE (Smad binding element) | Addgene | 2026-10-31 02:03:36 | 0 |
|
pCAG-ERas-IH Resource Report Resource Website |
RRID:Addgene_15688 | ERas | Mus musculus | Ampicillin | PMID:12774123 | Backbone Size:6400; Vector Backbone:pCAG-IH; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:03:36 | 0 | ||
|
pRetroSuper-GFP TIF1gamma Resource Report Resource Website 1+ mentions |
RRID:Addgene_15721 | TIF1 gamma shRNA | Homo sapiens | Ampicillin | PMID:16751102 | shRNA oligos were first cloned into pRetrosuper-Puro digested with BglII and HindIII. Next, the AgeI/XhoI fragments from shRNA sequence-containing pRetrosuper-Puro plasmids were cloned into the AgeI/XhoI site of pRetrosuper-GFP. Sense oligo: 5'-gatcccc GAAGATGTCT CAGAGTCTG ttcaagaga CAGACTCTGA GACATCTTC tttttggaaa-3'. | Backbone Size:6000; Vector Backbone:pRetrosuper-GFP; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:03:36 | 1 | |
|
pBABE YAP1 Resource Report Resource Website 10+ mentions |
RRID:Addgene_15682 | YAP | Homo sapiens | Ampicillin | PMID:16894141 | The human YAP ORF was cloned into the pBABEpuro vector as an EcoRI–BamHI fragment. A single FLAG tag was added to the N terminus during PCR with the following primers: Hs.YAP.F, CCGGGATCCACCATGGATTACAAGGATGACGACGATAAGATGGACCCCGGGCAGCAGCCCGCCGC; and Hs.YAP.R, CCGGAATTCCTATAACCATGTAAGAAAGCTTTC. | Backbone Marker:Available at Addgene (#1764); Backbone Size:5169; Vector Backbone:pBABE puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:03:36 | 17 | |
|
pET14b PHAS-I F113A Resource Report Resource Website |
RRID:Addgene_15680 | PHAS-I F113A | Rattus norvegicus | Ampicillin | PMID:12665511 | Full-length PHASI with a His tag. See author's map for detailed information. | Backbone Marker:Novagen; Backbone Size:4671; Vector Backbone:pET14b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | F113A mutation. | Addgene | 2026-10-31 02:03:36 | 0 |
|
rApoI Resource Report Resource Website |
RRID:Addgene_156459 | rApoI | Rattus norvegicus | Streptomycin | PMID:29991261 | Esherichia coli strain that expresses rat APOBEC1. Genotype: DH10B Δung ΔmotAB ΔcsgABCDEFG [PlacI<>Ptac] Δ(araA-leu)7697::[PA1lacO-Tenth rApo1] | Vector Backbone:None; Vector Types:; Bacterial Resistance:Streptomycin | Addgene | 2026-10-31 02:03:35 | 0 | |
|
T7 promoter + filler DNA reporter plasmid Resource Report Resource Website |
RRID:Addgene_156454 | NeoR/KanR | Tn5 | Ampicillin | PMID:29991261 | Please note that a low DNA yield is expected with single copy BACs. Using larger scale DNA preps (ie. midi preps) is recommended. If there are difficulties removing genomic DNA, the ExonucleaseV (recBCD) from NEB (M0345S) which degrades contaminating linear DNA can help improve results. | Backbone Size:5863; Vector Backbone:BAC; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | ATG start codon mutated to ACG | Addgene | 2026-10-31 02:03:35 | 0 |
|
L3574 Resource Report Resource Website |
RRID:Addgene_1566 | Ampicillin | See Fire Lab Vector Kit Documentation 1997. Fire Lab Miniprep Number pPD115.70, Ligation number L3574. | Backbone Size:6921; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:03:35 | 0 | ||||
|
T7 promoter + rpsL reporter plasmid Resource Report Resource Website |
RRID:Addgene_156455 | rpsL | Escherichia coli | Ampicillin | PMID:29991261 | Please note that a low DNA yield is expected with single copy BACs. Using larger scale DNA preps (ie. midi preps) is recommended. If there are difficulties removing genomic DNA, the ExonucleaseV (recBCD) from NEB (M0345S) which degrades contaminating linear DNA can help improve results. | Backbone Size:4732; Vector Backbone:BAC; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:03:35 | 0 | |
|
L3604 Resource Report Resource Website |
RRID:Addgene_1569 | Ampicillin | See Fire Lab Vector Kit Documentation 1997. Fire Lab Miniprep Number pPD115.99, Ligation number L3604. | Backbone Size:4816; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:03:36 | 0 | ||||
|
pRetroSuper TIF1gamma Resource Report Resource Website 1+ mentions |
RRID:Addgene_15728 | TIF1 gamma shRNA | Homo sapiens | Ampicillin | PMID:16751102 | shRNA oligos were cloned into pRetrosuper-Puro digested with BglII and HindIII. Sense oligo: 5'-gatcccc GAAGATGTCT CAGAGTCTG ttcaagaga CAGACTCTGA GACATCTTC tttttggaaa-3'. | Backbone Size:6400; Vector Backbone:pRetrosuper; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:03:36 | 3 | |
|
HybridJ-IRES-tauGFP LNL TV Resource Report Resource Website |
RRID:Addgene_15658 | HybridJ-IRES-tauGFP LNL TV | Mus musculus | Ampicillin | PMID:15186781 | The mouse strain that was derived from this plasmid is available from The Jackson Laboratory: http://jaxmice.jax.org/strain/006622.html | Backbone Size:3000; Vector Backbone:pBS; Vector Types:high copy number; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:03:35 | 0 | |
|
HybridH-IRES-tauGFP LNL TV Resource Report Resource Website |
RRID:Addgene_15656 | HybridH-IRES-tauGFP LNL TV | Mus musculus | Ampicillin | PMID:15186781 | The mouse strain that was derived from this plasmid is available from The Jackson Laboratory: http://jaxmice.jax.org/strain/006624.html | Backbone Size:3000; Vector Backbone:pBS; Vector Types:high copy number; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:03:35 | 0 | |
|
HybridF-IRES-tauGFP LNL TV Resource Report Resource Website |
RRID:Addgene_15654 | HybridF-IRES-tauGFP LNL TV | Mus musculus | Ampicillin | PMID:15186781 | The mouse strain that was derived from this plasmid is available from The Jackson Laboratory: http://jaxmice.jax.org/strain/006626.html | Backbone Size:3000; Vector Backbone:pBS; Vector Types:high copy number; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:03:35 | 0 | |
|
HybridB-IRES-tauLacZ LNL TV Resource Report Resource Website |
RRID:Addgene_15652 | HybridB-IRES-tauLacZ LNL TV | Mus musculus | Ampicillin | PMID:15186781 | The mouse strain that was derived from this plasmid is available from The Jackson Laboratory: http://jaxmice.jax.org/strain/006629.html | Backbone Size:3000; Vector Backbone:pBS; Vector Types:high copy number; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:03:35 | 0 | |
|
MutaT7 Resource Report Resource Website 1+ mentions |
RRID:Addgene_156460 | rApoI | Rattus norvegicus | Streptomycin | PMID:29991261 | Esherichia coli strain that expresses MutaT7, a fusion of rat APOBEC1 and the T7 RNA polymerase. Genotype: DH10B Δung ΔmotAB ΔcsgABCDEFG [PlacI<>Ptac] Δ(araA-leu)7697::[PA1lacO-Tenth MutaT7] | Vector Backbone:None; Vector Types:; Bacterial Resistance:Streptomycin | Addgene | 2026-10-31 02:03:35 | 1 | |
|
pFUSE-rIgG-Fc2-ICAM1 Resource Report Resource Website |
RRID:Addgene_156462 | Intercellular Adhesion Molecule 1 | Mus musculus | Bleocin (Zeocin) | PMID:32783949 | Depositor confirms P66S and L234P mutations does not affect plasmid function. | Backbone Marker:Invivogen; Backbone Size:4179; Vector Backbone:pFUSE; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Bleocin (Zeocin) | endogenous signal peptide replaced with IL2 signal sequence; membrane domain replaced with rabbit IgG Fc, P66S and L234P in ICAM (based on open reading frame) - please see depositor comments | Addgene | 2026-10-31 02:03:35 | 0 |
|
DV-GFP-Rab38-WT-pDEST53 Resource Report Resource Website |
RRID:Addgene_15669 | Rab38 | Mus musculus | Ampicillin | PMID:11917121 | Backbone Marker:Invitrogen; Backbone Size:6400; Vector Backbone:pcDNA-DEST53 Gateway; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | wildtype Rab38 sequence | Addgene | 2026-10-31 02:03:36 | 0 | |
|
pRetrosuper USP28 shRNA-3 Resource Report Resource Website |
RRID:Addgene_15664 | USP28 shRNA | Homo sapiens | Ampicillin | PMID:17558397 | hairpin targets the sequence: GTATGGACAAGAGCGTTGGT | Backbone Size:6400; Vector Backbone:pRetrosuper; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:03:36 | 0 | |
|
pRetrosuper USP28 shRNA-1 Resource Report Resource Website |
RRID:Addgene_15663 | USP28 shRNA | Homo sapiens | Ampicillin | PMID:17558397 | Hairpin targets the sequence: GGAGTGAGATTGAACAAGA. | Backbone Size:6400; Vector Backbone:pRetrosuper; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:03:36 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
