Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Marker:Kohchi Lab., Kyoto University; Backbone Size:10455; Vector Backbone:pMpGWB300; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Spectinomycin
Defining Citation: PMID:26406247
Proper citation: RRID:Addgene_68664 Copy
Vector Backbone Description: Backbone Marker:Kohchi Lab., Kyoto University; Backbone Size:10455; Vector Backbone:pMpGWB300; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Spectinomycin
Defining Citation: PMID:26406247
Proper citation: RRID:Addgene_68663 Copy
Species: Rattus norvegicus
Genetic Insert: mRuby2-P2A-GCaMP6s
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27284193
Comments: mRuby2:
Article: Improving FRET dynamic range with bright green and red fluorescent proteins. Lam et al (Nat Methods. 2012 Sep 9. doi: 10.1038/nmeth.2171. PubMed)
Addgene Plasmid 40260
GCaMP6s:
Article: Ultrasensitive fluorescent proteins for imaging neuronal activity. Chen et al (Nature. 2013 Jul 18;499(7458):295-300. doi: 10.1038/nature12354. PubMed)
Addgene Plasmid 40753
Proper citation: RRID:Addgene_68717 Copy
Species: Bacillus cereus
Genetic Insert: bsr
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26116467
Comments: Overall this plasmid contains bsr-GFP11-ires-puromycin resistance gene. GFP11 covers the 11th strand of GFP and the sequence is ctgcagcgcgatcacatggtcctgcacgagtacgtgaacgccgccgggatcact.
Proper citation: RRID:Addgene_68716 Copy
Vector Backbone Description: Backbone Marker:Kohchi Lab., Kyoto University; Backbone Size:9287; Vector Backbone:pMpGWB400; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Spectinomycin
Defining Citation: PMID:26406247
Proper citation: RRID:Addgene_68671 Copy
Vector Backbone Description: Backbone Marker:Kohchi Lab., Kyoto University; Backbone Size:9287; Vector Backbone:pMpGWB400; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Spectinomycin
Defining Citation: PMID:26406247
Proper citation: RRID:Addgene_68670 Copy
Species: Homo sapiens
Genetic Insert: H2B mCherry and TAZ/WWTR1
Vector Backbone Description: Vector Backbone:pLL3.7; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_68713 Copy
Vector Backbone Description: Backbone Marker:Kohchi Lab., Kyoto University; Backbone Size:9287; Vector Backbone:pMpGWB400; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Spectinomycin
Defining Citation: PMID:26406247
Proper citation: RRID:Addgene_68679 Copy
Vector Backbone Description: Backbone Marker:Kohchi Lab., Kyoto University; Backbone Size:9287; Vector Backbone:pMpGWB400; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Spectinomycin
Defining Citation: PMID:26406247
Proper citation: RRID:Addgene_68675 Copy
Vector Backbone Description: Backbone Marker:Kohchi Lab., Kyoto University; Backbone Size:9287; Vector Backbone:pMpGWB400; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Spectinomycin
Defining Citation: PMID:26406247
Proper citation: RRID:Addgene_68673 Copy
Species: Homo sapiens
Genetic Insert: FKBP12-rapamycin binding (FRB) domain of MTOR
Vector Backbone Description: Backbone Marker:Amersham Pharmacia Biotech; Vector Backbone:pGEX-2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9933627
Proper citation: RRID:Addgene_68726 Copy
Vector Backbone Description: Backbone Marker:Kohchi Lab., Kyoto University; Backbone Size:9287; Vector Backbone:pMpGWB400; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Spectinomycin
Defining Citation: PMID:26406247
Proper citation: RRID:Addgene_68682 Copy
Vector Backbone Description: Backbone Marker:Kohchi Lab., Kyoto University; Backbone Size:9287; Vector Backbone:pMpGWB400; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Spectinomycin
Defining Citation: PMID:26406247
Proper citation: RRID:Addgene_68688 Copy
Vector Backbone Description: Backbone Marker:Kohchi Lab., Kyoto University; Backbone Size:9287; Vector Backbone:pMpGWB400; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Spectinomycin
Defining Citation: PMID:26406247
Proper citation: RRID:Addgene_68687 Copy
Species: Rattus norvegicus
Genetic Insert: mRuby2-P2A-GCaMP6s
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27284193
Comments: mRuby2:
Article: Improving FRET dynamic range with bright green and red fluorescent proteins. Lam et al (Nat Methods. 2012 Sep 9. doi: 10.1038/nmeth.2171. PubMed)
Addgene Plasmid 40260
GCaMP6s:
Article: Ultrasensitive fluorescent proteins for imaging neuronal activity. Chen et al (Nature. 2013 Jul 18;499(7458):295-300. doi: 10.1038/nature12354. PubMed)
Addgene Plasmid 40753
Proper citation: RRID:Addgene_68720 Copy
Vector Backbone Description: Backbone Marker:Kohchi Lab., Kyoto University; Backbone Size:9287; Vector Backbone:pMpGWB400; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Spectinomycin
Defining Citation: PMID:26406247
Proper citation: RRID:Addgene_68686 Copy
Vector Backbone Description: Backbone Marker:Kohchi Lab., Kyoto University; Backbone Size:9287; Vector Backbone:pMpGWB400; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Spectinomycin
Defining Citation: PMID:26406247
Proper citation: RRID:Addgene_68685 Copy
Vector Backbone Description: Backbone Marker:Kohchi Lab., Kyoto University; Backbone Size:9287; Vector Backbone:pMpGWB400; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Spectinomycin
Defining Citation: PMID:26406247
Proper citation: RRID:Addgene_68684 Copy
Vector Backbone Description: Backbone Marker:Kohchi Lab., Kyoto University; Backbone Size:9021; Vector Backbone:pMpGWB200; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Spectinomycin
Defining Citation: PMID:26406247
Proper citation: RRID:Addgene_68619 Copy
Vector Backbone Description: Backbone Marker:Kohchi Lab., Kyoto University; Backbone Size:9021; Vector Backbone:pMpGWB200; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Spectinomycin
Defining Citation: PMID:26406247
Proper citation: RRID:Addgene_68618 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.