Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
|||||
|---|---|---|---|---|---|---|---|---|---|---|---|
|
ATF4 6: mCD36.GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_21853 | mCD36 | Mus musculus | Kanamycin | PMID:15479734 | These pEGFP-based plasmids have NEOr marker (and not the conventional AMPr marker). They should be propagated in the presence of 30mcg/ml kanamycin (and not on ampicillin) | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFPN-N2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | Only the first 13 AA of CD36 are fused to GFP | Addgene | 2026-10-31 02:07:31 | 2 |
|
ATF4 5: 5’ATF4.GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_21852 | ATF4 | Mus musculus | Kanamycin | PMID:15479734 | These pEGFP-based plasmids have NEOr marker (and not the conventional AMPr marker). They should be propagated in the presence of 30mcg/ml kanamycin (and not on ampicillin) | Backbone Marker:Clontech; Backbone Size:4733; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | Addgene | 2026-10-31 02:07:31 | 6 | |
|
ATF4 3: Mouse ATF4 (CHOP11/cATF), 5'UTR and AUG-luc Resource Report Resource Website 10+ mentions |
RRID:Addgene_21850 | ATF4 | Mus musculus | Ampicillin | PMID:11106749 | Addgene sequencing results show 2 mismatches with author's sequence and NCBI sequence for ATF4. Mouse ATF4 5' UTR and AUG fused to Luciferase driven by the TK promoter in a pGL3 backbone TK.mATF4.UTR.Luc.pGL3 (5202nt, predicted). TK promoter: 58..184; mATF4 5'UTR and AUG: 185..470; luciferase coding sequence: 472..2121; poly A signals: 2156..2377 | Backbone Marker:Promega; Backbone Size:5010; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | ATF4 5' UTR and AUG fused to Luciferase driven by the TK promoter | Addgene | 2026-10-31 02:07:30 | 10 |
|
pBAD33-mf-lon Resource Report Resource Website 1+ mentions |
RRID:Addgene_21867 | Lon | Mesoplasma florum | Chloramphenicol | PMID:18852454 | A detailed protocol for purification of mf-lon can be found in the associated paper. | Backbone Marker:Beckwith Lab; Backbone Size:5352; Vector Backbone:pBAD33; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol | all TGA codons changed to TGG codons | Addgene | 2026-10-31 02:07:31 | 2 |
|
ATF4 19: (SL)RLuc.5’ATF4.GFP Resource Report Resource Website |
RRID:Addgene_21865 | ATF4 | Mus musculus | Kanamycin | PMID:15479734 | Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | Stem Loop upstream of ATF4 | Addgene | 2026-10-31 02:07:31 | 0 | |
|
ATF4 13: 5’ATF4.uORF2AUA.GFP Resource Report Resource Website |
RRID:Addgene_21860 | ATF4 | Mus musculus | Kanamycin | PMID:15479734 | These pEGFP-based plasmids have NEOr marker (and not the conventional AMPr marker). They should be propagated in the presence of 30mcg/ml kanamycin (and not on ampicillin) | Backbone Marker:Clontech; Backbone Size:4733; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | AUG codon of uORF2 was converted to AUA | Addgene | 2026-10-31 02:07:31 | 0 |
|
ATF4 18: RLuc.5’ATF4.GFP Resource Report Resource Website |
RRID:Addgene_21864 | ATF4 | Mus musculus | Kanamycin | PMID:15479734 | Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | Addgene | 2026-10-31 02:07:31 | 0 | ||
|
ATF4 17: 5’ATF4.uORF1stopm1&2.GFP Resource Report Resource Website |
RRID:Addgene_21863 | ATF4 | Mus musculus | Kanamycin | PMID:15479734 | These pEGFP-based plasmids have NEOr marker (and not the conventional AMPr marker). They should be propagated in the presence of 30mcg/ml kanamycin (and not on ampicillin) | Backbone Marker:Clontech; Backbone Size:4733; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | Stop codons between the colinear uORF1 and uORF2 converted to UCG and UAC, respectively (see author's map) | Addgene | 2026-10-31 02:07:31 | 0 |
|
pBabe-TetCMV-puro-mVenus-PA-Rac1 Resource Report Resource Website |
RRID:Addgene_22008 | PA-Rac1 | Homo sapiens | Ampicillin | PMID:19693014 | Protocols for production and use of Hahn lab biosensors and photoactivatable proteins can be found on their web page, at the URL below. If you have suggestions for the protocols or have any questions, please feel free to contact the Hahn lab. Good luck with your experiments! Hahn lab biosensor protocol: http://www.hahnlab.com/tools/index.html Please note, Addgene has not confirmed all the mutations associated with this construct. We suggest sequence verifying this plasmid upon receipt. | Backbone Size:6000; Vector Backbone:pBabe-TetCMV-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | LOV(Leu404-Leu546), Rac1 starts at I4 and contains mutations Q61L, E91H and N92H. | Addgene | 2026-10-31 02:07:32 | 0 |
|
pSiP3 Resource Report Resource Website |
RRID:Addgene_21957 | Pten | Mus musculus | Ampicillin | PMID:18327259 | Backbone Size:6273; Vector Backbone:psiCHECK2; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:07:32 | 0 | ||
|
pTriEx-mVenus-PA-Rac1 Resource Report Resource Website 10+ mentions |
RRID:Addgene_22007 | PA-Rac1 | Homo sapiens | Ampicillin | PMID:19693014 | Protocols for production and use of Hahn lab biosensors and photoactivatable proteins can be found on their web page, at the URL below. If you have suggestions for the protocols or have any questions, please feel free to contact the Hahn lab. Good luck with your experiments! Hahn lab biosensor protocol: http://www.hahnlab.com/tools/index.html Please note, Addgene has not confirmed all the mutations associated with this construct. We suggest sequence verifying this plasmid upon receipt. Further remarks from the Hahn lab regarding some mutations in the fluorescent marker: "the C-S mutation was introduced by us to allow site specific labeling of the protein and we have not detected any effect. The F-L mutation reverts the Venus sequence back to the YFP sequence at this site. It will have a very slight detrimental effect on the maturation speed of the chromophore, but will not affect the stability or wavelength of the chromophore. Neither of these 2 mutations will have any effect on the function of the Lov-Rac construct , and the Venus will still function as it should, i.e. as a reporter for the construct." | Backbone Marker:Novagen; Backbone Size:6000; Vector Backbone:pTriEx; Vector Types:Mammalian Expression, Bacterial Expression, Insect Expression; Bacterial Resistance:Ampicillin | LOV(Leu404-Leu546), Rac1 starts at I4 and contains mutations Q61L, E91H and N92H. | Addgene | 2026-10-31 02:07:32 | 11 |
|
pSiP1 Resource Report Resource Website |
RRID:Addgene_21952 | Pten | Mus musculus | Ampicillin | PMID:18327259 | Backbone Marker:Promega; Backbone Size:6273; Vector Backbone:psiCHECK2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:07:32 | 0 | ||
|
CMV-d2eGFP-cxcr4 Resource Report Resource Website 1+ mentions |
RRID:Addgene_21967 | CMV d2eGFP CXCR4 control sponge | Ampicillin | PMID:17694064 | From Supplementary Table 1: "CXCR4 bulged Renilla luciferase reporter, 7 sites or 1 site; CMV sponge, 7 sites; U6 spong, 4 sites: AAGUUUUCAGAAAGCUAACA" | Backbone Size:5000; Vector Backbone:pcDNA5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:07:32 | 3 | ||
|
pCMV4 p65 Resource Report Resource Website 10+ mentions |
RRID:Addgene_21966 | NFkB p65 subunit | Homo sapiens | Ampicillin | PMID:1542686 | Backbone Marker:Andersson,S. et al, J. Biol. Chem. 264 (14), 8222-8229 (1989); Backbone Size:4874; Vector Backbone:pCMV4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | This construct was the product of 3 subcloning procedures: 1. XbaI-EcoRI-p65-EcoRI-KpnI from pBluescript II SK +/- was digested with XbaI/KpnI, and subcloned to M13 mp19. 2. HindIII-XbaI-p65-HindIII-KpnI from the M13 mp19 construct was digested with HindIII, then subcloned into pCMV4. 3. The resulting pCMV4 p65 plasmid can be liberated using HindIII, with a size of ~2.5 kb. The large size (p65 is only 1.5kb) is due to the inclusion of multiple polylinkers from pBluescript and M13mp19 as well as non-coding regions of p65. | Addgene | 2026-10-31 02:07:32 | 41 | |
|
pCMV4 p50 Resource Report Resource Website 10+ mentions |
RRID:Addgene_21965 | NF-kB p50 subunit | Homo sapiens | Ampicillin | PMID:1542686 | Backbone Marker:Andersson,S. et al, J. Biol. Chem. 264 (14), 8222-8229 (1989); Backbone Size:4874; Vector Backbone:pCMV4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:07:32 | 17 | ||
|
pLKO-shD Resource Report Resource Website 1+ mentions |
RRID:Addgene_21964 | si NEDD9 | Homo sapiens | Ampicillin | PMID:17676035 | Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | Addgene | 2026-10-31 02:07:32 | 2 | ||
|
pCE-BiFC-VN173 Resource Report Resource Website 1+ mentions |
RRID:Addgene_22019 | VN173 | Aequorea Victoria | Ampicillin | PMID:18388940 | Hiatt, S.M., Shyu, Y., Duren, H.M, and Hu, C.D. Bimolecular fluorescence complementation (BiFC) analysis of protein interactions in living C. elegans. Methods, 45:185-191 (2008) Multicloning sites betwee Myc and VN173 are avaialble | Backbone Marker:Fire lab 1995 kit; Backbone Size:3993; Vector Backbone:pPD4983; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | N/A | Addgene | 2026-10-31 02:07:32 | 3 |
|
pBiFC-CrN173 Resource Report Resource Website |
RRID:Addgene_22016 | CrN173 | Aequorea Victoria | Ampicillin | PMID:16454041 | Backbone Size:4694; Vector Backbone:pFLAG-CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | N/A | Addgene | 2026-10-31 02:07:32 | 0 | |
|
pTriEx-mVenus-PA-Rac1-T17N Resource Report Resource Website 1+ mentions |
RRID:Addgene_22017 | PA-Rac1-T17N | Homo sapiens | Ampicillin | PMID:19693014 | Protocols for production and use of Hahn lab biosensors and photoactivatable proteins can be found on their web page, at the URL below. If you have suggestions for the protocols or have any questions, please feel free to contact the Hahn lab. Good luck with your experiments! Hahn lab biosensor protocol: http://www.hahnlab.com/tools/index.html Please note, Addgene has not confirmed all the mutations associated with this construct. We suggest sequence verifying this plasmid upon receipt. | Backbone Marker:Novagen; Backbone Size:6000; Vector Backbone:pTriEx; Vector Types:Mammalian Expression, Bacterial Expression, Insect Expression; Bacterial Resistance:Ampicillin | Rac1 starts at I4 and contains mutation T17N. | Addgene | 2026-10-31 02:07:32 | 1 |
|
pBabe-TetCMV-puro-mVenus-PA-Rac1-T17N Resource Report Resource Website |
RRID:Addgene_22018 | mVenus-PA-Rac1-T17N | Homo sapiens | Ampicillin | PMID:19693014 | Protocols for production and use of Hahn lab biosensors and photoactivatable proteins can be found on their web page, at the URL below. If you have suggestions for the protocols or have any questions, please feel free to contact the Hahn lab. Good luck with your experiments! Hahn lab biosensor protocol: http://www.hahnlab.com/tools/index.html Please note, Addgene has not confirmed all the mutations associated with this construct. We suggest sequence verifying this plasmid upon receipt. | Backbone Size:6000; Vector Backbone:pBabe-TetCMV-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | Rac1 starts at I4 and contains mutation T17N. | Addgene | 2026-10-31 02:07:32 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
