Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: SP-Cas9-VPR
Vector Backbone Description: Vector Backbone:hCas9 Plasmid #41815; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26344044
Proper citation: RRID:Addgene_68497 Copy
Species: Synthetic
Genetic Insert: INT construct_bearing the GFP aptamer
Vector Backbone Description: Backbone Marker:NEB; Vector Backbone:pNEB193; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26030444
Comments: sgRNA targets the (ATCTAGATACGACTCACTAT) sequence in the Gluc reporter. Contains an internal "accessory domain," comprising a GFP aptamer.
Proper citation: RRID:Addgene_68428 Copy
Species: Synthetic
Genetic Insert: INT construct_bearing three MS2 Stem-loops
Vector Backbone Description: Backbone Marker:NEB; Vector Backbone:pNEB193; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26030444
Comments: sgRNA targets the (ATCTAGATACGACTCACTAT) sequence in the Gluc reporter. Contains an internal "accessory domain," comprising a casette of MS2 stem-loops
Proper citation: RRID:Addgene_68426 Copy
Species: Synthetic
Genetic Insert: INT construct with S1 streptavidin aptamer
Vector Backbone Description: Backbone Marker:NEB; Vector Backbone:pNEB193; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26030444
Comments: sgRNA targets the (ATCTAGATACGACTCACTAT) sequence in the Gluc reporter. Contains an internal "accessory domain," comprising the S1 streptavidin aptamer
Proper citation: RRID:Addgene_68425 Copy
Species: Synthetic
Genetic Insert: TOP1 construct
Vector Backbone Description: Backbone Marker:NEB; Vector Backbone:pNEB193; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26030444
Comments: sgRNA core targets the (ATCTAGATACGACTCACTAT) sequence in the Gluc reporter. Contains a 3'-"accessory domain," comprising the T. thermophilia P4-P6 domain appended with a casette of PP7 stem-loops
Proper citation: RRID:Addgene_68423 Copy
Species: Other
Genetic Insert: L7Ae
Vector Backbone Description: Backbone Marker:NEB; Vector Backbone:pNEB193; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26030444
Comments: Contains an N-terminal 3xNLS cassette
Proper citation: RRID:Addgene_68421 Copy
Species: Other
Genetic Insert: MS2
Vector Backbone Description: Backbone Marker:NEB; Vector Backbone:pNEB193; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26030444
Comments: Contains an N-terminal 3xNLS cassette. Contains a single copy of the MS2 protein fused to mCherry.
Proper citation: RRID:Addgene_68420 Copy
Species: Synthetic
Genetic Insert: INT construct_bearing the "Spinach2" aptamer
Vector Backbone Description: Backbone Marker:NEB; Vector Backbone:pNEB193; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26030444
Comments: sgRNA targets the (ATCTAGATACGACTCACTAT) sequence in the Gluc reporter. Contains an internal "accessory domain," comprising the "Spinach2" aptamer
Proper citation: RRID:Addgene_68430 Copy
Species: Mus musculus
Genetic Insert: Cav3
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:10385524
Proper citation: RRID:Addgene_68396 Copy
Species: Synthetic
Genetic Insert: V48 ELP
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5547; Vector Backbone:PET25b+; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22434766
Proper citation: RRID:Addgene_68395 Copy
Species: Synthetic
Genetic Insert: S48I48 ELP
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5547; Vector Backbone:PET25b+; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22434766
Proper citation: RRID:Addgene_68394 Copy
Species: Synthetic
Genetic Insert: V96 ELP
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5547; Vector Backbone:PET25b+; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22434766
Proper citation: RRID:Addgene_68392 Copy
Species: Synthetic
Genetic Insert: Knob-S48I48
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5547; Vector Backbone:Pet25b+; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21699930
Proper citation: RRID:Addgene_68391 Copy
Species: Synthetic
Genetic Insert: INT construct_bearing three PP7 Stem-loops
Vector Backbone Description: Backbone Marker:NEB; Vector Backbone:pNEB193; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26030444
Comments: sgRNA core targets the (ATCTAGATACGACTCACTAT) sequence in the Gluc reporter. Contains an internal "accessory domain," comprising a casette of PP7 stem-loops. Trascription termination is by the U1 snRNA 3' Box system, preceeded by the U2 snRNA sm Box.
Proper citation: RRID:Addgene_68438 Copy
Species: Synthetic
Genetic Insert: TOP1 construct
Vector Backbone Description: Backbone Marker:NEB; Vector Backbone:pNEB193; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26030444
Comments: sgRNA core targets the (ATCTAGATACGACTCACTAT) sequence in the Gluc reporter. Contains a 3' -"accessory domain," comprising the T. thermophilia P4-P6 domain appended with a casette of PP7 stem-loops. Trascription termination is by the U1 snRNA 3' Box system, preceeded by the U2 snRNA sm Box.
Proper citation: RRID:Addgene_68437 Copy
Species: Synthetic
Genetic Insert: INT construct_bearing three PP7 Stem-loops
Vector Backbone Description: Backbone Marker:NEB; Vector Backbone:pNEB193; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26030444
Comments: sgRNA targets the (ATCTAGATACGACTCACTAT) sequence in the Gluc reporter. Contains an internal "accessory domain," comprising a casette of PP7 stem-loops. Trascription termination is by the U1 snRNA 3' Box system.
Proper citation: RRID:Addgene_68436 Copy
Species: Mus musculus
Genetic Insert: SRBC
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19546242
Proper citation: RRID:Addgene_68399 Copy
Species: Mus musculus
Genetic Insert: SDPR
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19546242
Proper citation: RRID:Addgene_68398 Copy
Genetic Insert: mKusabira-Orange2
Vector Backbone Description: Backbone Size:3524; Vector Backbone:TOPO 2-5; Vector Types:Bacterial Expression, GMAP; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26887506
Proper citation: RRID:Addgene_68442 Copy
Genetic Insert: Elongation Factor 1α Promoter
Vector Backbone Description: Backbone Size:3519; Vector Backbone:TOPO 1-4; Vector Types:Bacterial Expression, GMAP; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26887506
Proper citation: RRID:Addgene_68451 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
