Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

740,584 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
px330_P53 exon 7 gRNA
 
Resource Report
Resource Website 		RRID:Addgene_68351 P53 exon 7 gRNA Synthetic Ampicillin Backbone Size:2500; Vector Backbone:amp; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:09:15 0
px330_SMAD exon 2 gRNA
 
Resource Report
Resource Website 		RRID:Addgene_68350 SMAD exon 2 gRNA Synthetic Ampicillin Backbone Size:2500; Vector Backbone:amp; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:09:15 0
pMPO 51
 
Resource Report
Resource Website 		RRID:Addgene_68358 Ampicillin PMID:21829692 Vector Backbone:pCASB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:09:15 0
5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9 probasin_mTQ2_FlpO
 
Resource Report
Resource Website 		RRID:Addgene_68357 5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9 Synthetic Ampicillin Backbone Size:2500; Vector Backbone:Amp; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-29 01:09:15 0
PL552
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_68407 Ampicillin PMID:26145478 Backbone Marker:Frederick National Lab; Backbone Size:4800; Vector Backbone:PL452; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin 2026-08-29 01:09:16 12
MSCV Puro-EFS:GFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_68484 Puromycin Resistance Ampicillin PMID:26887506 Backbone Size:5160; Vector Backbone:MSCV 2-5; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-29 01:09:17 1
MSCV Puro-SV40:GFP
 
Resource Report
Resource Website 		RRID:Addgene_68483 Puromycin Resistance Ampicillin PMID:26887506 Backbone Size:5160; Vector Backbone:MSCV 2-5; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-29 01:09:17 0
MSCV Puro-UBC:GFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_68482 Puromycin Resistance Ampicillin PMID:26887506 Backbone Size:5160; Vector Backbone:MSCV 2-5; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-29 01:09:17 1
pGK:HygroR-CMV:mKate2-B_UTR
 
Resource Report
Resource Website 		RRID:Addgene_68480 Hygromycin Resistance Ampicillin PMID:26887506 Backbone Size:5818; Vector Backbone:LV 1-5; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-29 01:09:17 0
pCMV-TNT-CFP-STIM1-C227W
 
Resource Report
Resource Website 		RRID:Addgene_68403 CFP-STIM1 Homo sapiens Ampicillin PMID:26184105 Backbone Size:4050; Vector Backbone:pCMVTnT™ Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Changed Cysteine 227 to Tryptophan; CFP was inserted into STIM between G37 and A38. 2026-08-29 01:09:16 0
pEGFP-PTRF
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_68401 PTRF Mus musculus Kanamycin PMID:18191225 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-29 01:09:16 3
TOPO CFP
 
Resource Report
Resource Website 		RRID:Addgene_68489 Cyan Fluorescent Protein Kanamycin PMID:26887506 Backbone Size:3584; Vector Backbone:TOPO 2-5; Vector Types:Bacterial Expression, GMAP; Bacterial Resistance:Kanamycin 2026-08-29 01:09:17 0
MSCV Puro-CCSP:GFP
 
Resource Report
Resource Website 		RRID:Addgene_68487 Puromycin Resistance Ampicillin PMID:26887506 Backbone Size:5160; Vector Backbone:MSCV 2-5; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-29 01:09:17 0
pEF_dCas9-VP64
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_68417 dCas9 Other Ampicillin PMID:26030444 Contains NLS sequences at the N- and C-terminus of the dCas9 protein. The C-terminal NLS immediately preceedes the 3xFLAG tag Backbone Marker:NEB; Vector Backbone:pNEB193; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin D10A/H841A 2026-08-29 01:09:16 1
TOPO Venus
 
Resource Report
Resource Website 		RRID:Addgene_68493 split Venus Kanamycin PMID:26887506 Backbone Size:3584; Vector Backbone:TOPO 2-5; Vector Types:Bacterial Expression, GMAP; Bacterial Resistance:Kanamycin 2026-08-29 01:09:17 0
TOPO mT2
 
Resource Report
Resource Website 		RRID:Addgene_68491 mTurquoise2 Kanamycin PMID:26887506 Backbone Size:3584; Vector Backbone:TOPO 2-5; Vector Types:Bacterial Expression, GMAP; Bacterial Resistance:Kanamycin 2026-08-29 01:09:17 0
pEF_dCas9
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_68416 dCas9 Other Ampicillin PMID:26030444 Contains NLS sequences at the N- and C-terminus of the dCas9 protein. The C-terminal NLS immediately preceedes the 3xFLAG tag Backbone Marker:NEB; Vector Backbone:pNEB193; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin D10A/H841A 2026-08-29 01:09:16 5
pLenti_9xD3B_Cluc_Norm
 
Resource Report
Resource Website 		RRID:Addgene_68414 Cypridina Luciferase-2A-Venus YFP Other Ampicillin PMID:26030444 Reporters are separated by 2A "self-cleaving" peptides. The reporter cassette is under the control of a minimal CMV promoter, preceeded by a casette of nine (ATCTAGATCGCCCGTCCCCT)AGG sites. The Tet-reponsive promoter and Gateway cloning sites were removed from the parent vector. Backbone Marker:Life Technologies; Vector Backbone:pLenti6.3/TO/V5-DEST; Vector Types:Lentiviral, Luciferase; Bacterial Resistance:Ampicillin YFP: M153T,V163A,S175G ("Venus") YFP Variant 2026-08-29 01:09:16 0
R26TV CAG LSL 2-5
 
Resource Report
Resource Website 		RRID:Addgene_68412 Ampicillin PMID:26887506 Backbone Size:14616; Vector Backbone:pBSII; Vector Types:Mammalian Expression, Mouse Targeting, Cre/Lox, GMAP; Bacterial Resistance:Ampicillin 2026-08-29 01:09:16 0
M-ST1-VPR
 
Resource Report
Resource Website 		RRID:Addgene_68498 ST-Cas9-VPR Synthetic Ampicillin PMID:26344044 Vector Backbone:M-ST1cas Plasmid #48669; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:09:17 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

dkNET community events and announcements in August, 2026

HIRN Funding Opportunity: SPARKS Award

Join the Whole Person Physiome 1st Data Jamboree on August 24-25

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch