Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: P53 exon 7 gRNA
Vector Backbone Description: Backbone Size:2500; Vector Backbone:amp; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_68351 Copy
Species: Synthetic
Genetic Insert: SMAD exon 2 gRNA
Vector Backbone Description: Backbone Size:2500; Vector Backbone:amp; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_68350 Copy
Vector Backbone Description: Vector Backbone:pCASB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21829692
Proper citation: RRID:Addgene_68358 Copy
Species: Synthetic
Genetic Insert: 5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9
Vector Backbone Description: Backbone Size:2500; Vector Backbone:Amp; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_68357 Copy
Vector Backbone Description: Backbone Marker:Frederick National Lab; Backbone Size:4800; Vector Backbone:PL452; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26145478
Proper citation: RRID:Addgene_68407 Copy
Genetic Insert: Puromycin Resistance
Vector Backbone Description: Backbone Size:5160; Vector Backbone:MSCV 2-5; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26887506
Proper citation: RRID:Addgene_68484 Copy
Genetic Insert: Puromycin Resistance
Vector Backbone Description: Backbone Size:5160; Vector Backbone:MSCV 2-5; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26887506
Proper citation: RRID:Addgene_68483 Copy
Genetic Insert: Puromycin Resistance
Vector Backbone Description: Backbone Size:5160; Vector Backbone:MSCV 2-5; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26887506
Proper citation: RRID:Addgene_68482 Copy
Genetic Insert: Hygromycin Resistance
Vector Backbone Description: Backbone Size:5818; Vector Backbone:LV 1-5; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26887506
Proper citation: RRID:Addgene_68480 Copy
Species: Homo sapiens
Genetic Insert: CFP-STIM1
Vector Backbone Description: Backbone Size:4050; Vector Backbone:pCMVTnT™ Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26184105
Proper citation: RRID:Addgene_68403 Copy
Species: Mus musculus
Genetic Insert: PTRF
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18191225
Proper citation: RRID:Addgene_68401 Copy
Genetic Insert: Cyan Fluorescent Protein
Vector Backbone Description: Backbone Size:3584; Vector Backbone:TOPO 2-5; Vector Types:Bacterial Expression, GMAP; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26887506
Proper citation: RRID:Addgene_68489 Copy
Genetic Insert: Puromycin Resistance
Vector Backbone Description: Backbone Size:5160; Vector Backbone:MSCV 2-5; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26887506
Proper citation: RRID:Addgene_68487 Copy
Species: Other
Genetic Insert: dCas9
Vector Backbone Description: Backbone Marker:NEB; Vector Backbone:pNEB193; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26030444
Comments: Contains NLS sequences at the N- and C-terminus of the dCas9 protein. The C-terminal NLS immediately preceedes the 3xFLAG tag
Proper citation: RRID:Addgene_68417 Copy
Genetic Insert: split Venus
Vector Backbone Description: Backbone Size:3584; Vector Backbone:TOPO 2-5; Vector Types:Bacterial Expression, GMAP; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26887506
Proper citation: RRID:Addgene_68493 Copy
Genetic Insert: mTurquoise2
Vector Backbone Description: Backbone Size:3584; Vector Backbone:TOPO 2-5; Vector Types:Bacterial Expression, GMAP; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26887506
Proper citation: RRID:Addgene_68491 Copy
Species: Other
Genetic Insert: dCas9
Vector Backbone Description: Backbone Marker:NEB; Vector Backbone:pNEB193; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26030444
Comments: Contains NLS sequences at the N- and C-terminus of the dCas9 protein. The C-terminal NLS immediately preceedes the 3xFLAG tag
Proper citation: RRID:Addgene_68416 Copy
Species: Other
Genetic Insert: Cypridina Luciferase-2A-Venus YFP
Vector Backbone Description: Backbone Marker:Life Technologies; Vector Backbone:pLenti6.3/TO/V5-DEST; Vector Types:Lentiviral, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26030444
Comments: Reporters are separated by 2A "self-cleaving" peptides. The reporter cassette is under the control of a minimal CMV promoter, preceeded by a casette of nine (ATCTAGATCGCCCGTCCCCT)AGG sites. The Tet-reponsive promoter and Gateway cloning sites were removed from the parent vector.
Proper citation: RRID:Addgene_68414 Copy
Vector Backbone Description: Backbone Size:14616; Vector Backbone:pBSII; Vector Types:Mammalian Expression, Mouse Targeting, Cre/Lox, GMAP; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26887506
Proper citation: RRID:Addgene_68412 Copy
Species: Synthetic
Genetic Insert: ST-Cas9-VPR
Vector Backbone Description: Vector Backbone:M-ST1cas Plasmid #48669; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26344044
Proper citation: RRID:Addgene_68498 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
