Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

745,085 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Authority

Sort Ascending

Sort Descending

 Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pDMG5a
 
Resource Report
Resource Website 		RRID:Addgene_33170 nsy-1 3'UTR Caenorhabditis elegans Ampicillin PMID:21909094 Backbone Marker:Addgene (#12179); Backbone Size:4085; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:08:59 0
pDMG6c
 
Resource Report
Resource Website 		RRID:Addgene_33175 fkh-8 3' UTR Caenorhabditis elegans Ampicillin PMID:21909094 Backbone Marker:Addgene (#12179); Backbone Size:4085; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin LTA site: tacGaTa Addgene 2026-10-31 02:09:00 0
pDMG5c
 
Resource Report
Resource Website 		RRID:Addgene_33172 nsy-1 3'UTR Caenorhabditis elegans Ampicillin PMID:21909094 Backbone Marker:Addgene (#12179); Backbone Size:4085; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin LTA site: tacGaTa Addgene 2026-10-31 02:09:00 0
pDMG6a
 
Resource Report
Resource Website 		RRID:Addgene_33173 fkh-8 3' UTR Caenorhabditis elegans Ampicillin PMID:21909094 Backbone Marker:Addgene (#12179); Backbone Size:4085; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:09:00 0
pDMG1i
 
Resource Report
Resource Website 		RRID:Addgene_33219 cog-1 3'UTR Caenorhabditis elegans Ampicillin PMID:21909094 Backbone Marker:Addgene (#12179); Backbone Size:4085; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 1st site GU6 Addgene 2026-10-31 02:09:00 0
pDMG1g
 
Resource Report
Resource Website 		RRID:Addgene_33217 cog-1 3'UTR Caenorhabditis elegans Ampicillin PMID:21909094 Backbone Marker:Addgene (#12179); Backbone Size:4085; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 1st site GU3 Addgene 2026-10-31 02:09:00 0
pDMG4a
 
Resource Report
Resource Website 		RRID:Addgene_33167 ptp-1 3'UTR Caenorhabditis elegans Ampicillin PMID:21909094 Backbone Marker:Addgene (#12179); Backbone Size:4085; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:08:59 0
pAG247
 
Resource Report
Resource Website 		RRID:Addgene_33200 LRIG1 Homo sapiens Ampicillin PMID:21909094 Backbone Marker:Addgene plasmid #12177; Backbone Size:3745; Vector Backbone:pIS2; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:09:00 0
pDMG4b
 
Resource Report
Resource Website 		RRID:Addgene_33168 ptp-1 3'UTR Caenorhabditis elegans Ampicillin PMID:21909094 Backbone Marker:Addgene (#12179); Backbone Size:4085; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin miR-142 sites: CacTaCa, aCacTaCa Addgene 2026-10-31 02:08:59 0
pCS247
 
Resource Report
Resource Website 		RRID:Addgene_33201 LRIG1 Homo sapiens Ampicillin PMID:21909094 Backbone Marker:Addgene plasmid #12177; Backbone Size:3745; Vector Backbone:pIS2; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin miR-CGCG sites: aCgCgaa, aaCgCgaa Addgene 2026-10-31 02:09:00 0
pDMG3b
 
Resource Report
Resource Website 		RRID:Addgene_33165 F55G1.12 3'UTR Caenorhabditis elegans Ampicillin PMID:21909094 Backbone Marker:Addgene (#12179); Backbone Size:4085; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin miR-142 site: aCacTaCa Addgene 2026-10-31 02:08:59 0
pDMG3c
 
Resource Report
Resource Website 		RRID:Addgene_33166 F55G1.12 3'UTR Caenorhabditis elegans Ampicillin PMID:21909094 Backbone Marker:Addgene (#12179); Backbone Size:4085; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin LTA site: atacGaTa Addgene 2026-10-31 02:08:59 0
pAG253
 
Resource Report
Resource Website 		RRID:Addgene_33208 RAP1A Homo sapiens Ampicillin PMID:21909094 Backbone Marker:Addgene plasmid #12177; Backbone Size:3745; Vector Backbone:pIS2; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:09:00 0
pCS252
 
Resource Report
Resource Website 		RRID:Addgene_33207 MAP4K4 3'UTR Homo sapiens Ampicillin PMID:21909094 Backbone Marker:Addgene plasmid #12177; Backbone Size:3745; Vector Backbone:pIS2; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin miR-CGCG sites: aaCgCga, aaCgCgaa Addgene 2026-10-31 02:09:00 0
pAC-Cyc
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_33156 Cyc Drosophila melanogaster Ampicillin PMID:18494558 Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pAc5.1/V5-His A; Vector Types:Insect Expression, Retroviral; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:08:59 1
pAC-Luc
 
Resource Report
Resource Website 		RRID:Addgene_33154 Ampicillin PMID:17578907 Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pAc5.1/V5-His B; Vector Types:Insect Expression, Luciferase; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:08:59 0
pDMG1b
 
Resource Report
Resource Website 		RRID:Addgene_33159 cog-1 3'UTR Caenorhabditis elegans Ampicillin PMID:21909094 Backbone Marker:Addgene (#12179); Backbone Size:4085; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin miR-142 sites: aCacTaCa, aCacTaCa Addgene 2026-10-31 02:08:59 0
pMXs-mGLIS1
 
Resource Report
Resource Website 		RRID:Addgene_33273 GLIS1, Gateway casette A Mus musculus Ampicillin PMID:21654807 Backbone Marker:Dr. Toshio Kitamura; Backbone Size:4700; Vector Backbone:pMXs; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:09:00 0
pAC-dCLK
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_33153 CLK Drosophila melanogaster Ampicillin PMID:11158307 Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pAc5.1/V5-His B; Vector Types:Insect Expression, Retroviral; Bacterial Resistance:Ampicillin Addgene 2026-10-31 02:08:59 1
pLG-Nde-Acc
 
Resource Report
Resource Website 		RRID:Addgene_33150 RP51A-synthetic minimal intron Saccharomyces cerevisiae Ampicillin PMID:2655924 Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin AccI site in intron was cut/filled/ligated to change GTCGAC to GTCGCGAC, and NdeI site after intron was cut/filled and a BamHI linker was inserted to obtain the appropriate reading frame changing CATATG to CATACGGGATCC Addgene 2026-10-31 02:08:59 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

Join the NIDDK-CR Webinar "Pixels to Phenotypes – Whole Slide Imaging Pathomics” on October 28, 2026

dkNET Webinar: Gene Regulatory Network Analysis in Texera

dkNET Webinar: A Hormone Cell Atlas Maps the Human Endocrine System at Cellular Resolution

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch