Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 280 showing 5581 ~ 5600 out of 740,584 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/76120

Species: Homo sapiens
Genetic Insert: NEK5
Vector Backbone Description: Backbone Marker:Zhang Lab (Addgene plasmid # 52963); Vector Backbone:lentiGuide-Puro; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26780180
Comments: The gRNA was designed to target the following Genbank reference sequence(s): NM_199289.2. Note that this plasmid does NOT contain Cas9. It should be used in conjunction with lentiCas9-Blast (Addgene #52962) or otherwise with cell lines already expressing Cas9. Browse the full kinome gRNA library at http://www.addgene.org/pooled-library/broadgpp-human-kinome/ or visit http://www.broadinstitute.org/rnai/public/ for detailed protocols and information.

Proper citation: RRID:Addgene_76120 Copy   


http://www.addgene.org/76121

Species: Homo sapiens
Genetic Insert: MAST1
Vector Backbone Description: Backbone Marker:Zhang Lab (Addgene plasmid # 52963); Vector Backbone:lentiGuide-Puro; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26780180
Comments: The gRNA was designed to target the following Genbank reference sequence(s): NM_014975.2. Note that this plasmid does NOT contain Cas9. It should be used in conjunction with lentiCas9-Blast (Addgene #52962) or otherwise with cell lines already expressing Cas9. Browse the full kinome gRNA library at http://www.addgene.org/pooled-library/broadgpp-human-kinome/ or visit http://www.broadinstitute.org/rnai/public/ for detailed protocols and information.

Proper citation: RRID:Addgene_76121 Copy   


http://www.addgene.org/76128

Species: Homo sapiens
Genetic Insert: NEK1
Vector Backbone Description: Backbone Marker:Zhang Lab (Addgene plasmid # 52963); Vector Backbone:lentiGuide-Puro; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26780180
Comments: The gRNA was designed to target the following Genbank reference sequence(s): NM_001199397.1,NM_001199398.1,NM_001199399.1,NM_001199400.1,NM_012224.2. Note that this plasmid does NOT contain Cas9. It should be used in conjunction with lentiCas9-Blast (Addgene #52962) or otherwise with cell lines already expressing Cas9. Browse the full kinome gRNA library at http://www.addgene.org/pooled-library/broadgpp-human-kinome/ or visit http://www.broadinstitute.org/rnai/public/ for detailed protocols and information.

Proper citation: RRID:Addgene_76128 Copy   


http://www.addgene.org/76129

Species: Homo sapiens
Genetic Insert: MYT1
Vector Backbone Description: Backbone Marker:Zhang Lab (Addgene plasmid # 52963); Vector Backbone:lentiGuide-Puro; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26780180
Comments: The gRNA was designed to target the following Genbank reference sequence(s): NM_004535.2. Note that this plasmid does NOT contain Cas9. It should be used in conjunction with lentiCas9-Blast (Addgene #52962) or otherwise with cell lines already expressing Cas9. Browse the full kinome gRNA library at http://www.addgene.org/pooled-library/broadgpp-human-kinome/ or visit http://www.broadinstitute.org/rnai/public/ for detailed protocols and information.

Proper citation: RRID:Addgene_76129 Copy   


http://www.addgene.org/68243

Species: Other
Genetic Insert: Solanum lycopersicum intergenic region
Vector Backbone Description: Backbone Marker:self-made; derived from pGreenII generated at the JIC; Vector Backbone:pDGB1_omega2; Vector Types:Synthetic Biology, Unspecified; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23669743
Comments: insert can be released with BsaI

Proper citation: RRID:Addgene_68243 Copy   


http://www.addgene.org/68242

Species: Other
Genetic Insert: Solanum lycopersicum intergenic region
Vector Backbone Description: Backbone Marker:self-made; derived from pGreenII generated at the JIC; Vector Backbone:pDGB1_omega1; Vector Types:Synthetic Biology, Unspecified; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23669743
Comments: insert can be released with BsaI

Proper citation: RRID:Addgene_68242 Copy   


  • RRID:Addgene_68241

http://www.addgene.org/68241

Species: Other
Genetic Insert: empty vector
Vector Backbone Description: Backbone Marker:self-made; derived from pCambia1302 generated at the Cambia Institute; Vector Backbone:pDGB3_omega2R; Vector Types:Plant Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23669743

Proper citation: RRID:Addgene_68241 Copy   


  • RRID:Addgene_68240

http://www.addgene.org/68240

Species: Other
Genetic Insert: empty vector
Vector Backbone Description: Backbone Marker:self-made; derived from pCambia1302 generated at the Cambia Institute; Vector Backbone:pDGB3_omega1R; Vector Types:Plant Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23669743

Proper citation: RRID:Addgene_68240 Copy   


  • RRID:Addgene_68253

http://www.addgene.org/68253

Species: Triticum aestivum (wheat) and synthetic
Genetic Insert: Promote:TaU6+sgRNA HvPM19_1
Vector Backbone Description: Vector Backbone:pICH47761 (AddGene #48003); Vector Types:Plant Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26616834
Comments: Target seq: GCTCTCCACTCTGGGCTCTT

Proper citation: RRID:Addgene_68253 Copy   


  • RRID:Addgene_68252

    This resource has 1+ mentions.

http://www.addgene.org/68252

Species: Cauliflower Mosaic Virus, Tobacco Mosaic Virus, Escherichia coli and Agrobacterium tumefaciens
Genetic Insert: Promoter:2x35s+5'UTR:Omega+CDS:nptII+3'UTR/terminator:Nos
Vector Backbone Description: Vector Backbone:pICH47732 (AddGene #48000); Vector Types:Plant Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26616834

Proper citation: RRID:Addgene_68252 Copy   


  • RRID:Addgene_68259

    This resource has 1+ mentions.

http://www.addgene.org/68259

Species: E. coli
Genetic Insert: Coding sequence, hygromycin phophotransferase II (Escherichia coli)
Vector Backbone Description: Vector Backbone:pICH41308 AddGene #47998; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:26616834

Proper citation: RRID:Addgene_68259 Copy   


  • RRID:Addgene_68257

http://www.addgene.org/68257

Species: Zea mays
Genetic Insert: Promoter and 5UTR Ubiquitin (Zea mays)
Vector Backbone Description: Vector Backbone:pICH41295 AddGene #47997; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:26616834

Proper citation: RRID:Addgene_68257 Copy   


  • RRID:Addgene_68256

http://www.addgene.org/68256

Species: Arabidopsis thaliana
Genetic Insert: Promoter_AtU6-26 + sgRNA_BolC.GA4a-2
Vector Backbone Description: Vector Backbone:pICH47761 (AddGene #48003); Vector Types:Plant Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26616834
Comments: Target sequence: GTTGAGAGGGGAGCCGGTGA

Proper citation: RRID:Addgene_68256 Copy   


  • RRID:Addgene_68261

    This resource has 1+ mentions.

http://www.addgene.org/68261

Species: Arabidopsis thaliana
Genetic Insert: Promoter: U6-26 (Arabidopsis thaliana)
Vector Backbone Description: Vector Backbone:pAGM9121; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:26616834

Proper citation: RRID:Addgene_68261 Copy   


  • RRID:Addgene_68260

    This resource has 1+ mentions.

http://www.addgene.org/68260

Species: E. coli
Genetic Insert: Coding sequence, neomycin phophotransferase II (Escherichia coli)
Vector Backbone Description: Vector Backbone:pICH41308 AddGene #47998; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:26616834

Proper citation: RRID:Addgene_68260 Copy   


  • RRID:Addgene_68157

http://www.addgene.org/68157

Species: Homo sapiens
Genetic Insert: A33
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4800; Vector Backbone:pGL3 Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12114523

Proper citation: RRID:Addgene_68157 Copy   


  • RRID:Addgene_68162

http://www.addgene.org/68162

Species: Arabidopsis thaliana
Genetic Insert: At2S3 promoter
Vector Backbone Description: Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23669743
Comments: insert can be released with BsaI

Proper citation: RRID:Addgene_68162 Copy   


  • RRID:Addgene_68204

http://www.addgene.org/68204

Species: Other
Genetic Insert: Hygromycin resistance gene coding region
Vector Backbone Description: Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23669743
Comments: insert can be released with BsaI

Proper citation: RRID:Addgene_68204 Copy   


  • RRID:Addgene_68203

http://www.addgene.org/68203

Species: Other
Genetic Insert: GUS coding region
Vector Backbone Description: Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23669743
Comments: insert can be released with BsaI

Proper citation: RRID:Addgene_68203 Copy   


  • RRID:Addgene_68169

http://www.addgene.org/68169

Species: Other
Genetic Insert: SlTCTP promoter
Vector Backbone Description: Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23669743
Comments: insert can be released with BsaI

Proper citation: RRID:Addgene_68169 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X