Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Issues Status:no known issues (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

740,584 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
NEK5 gRNA (BRDN0001148037)
 
Resource Report
Resource Website 		RRID:Addgene_76120 NEK5 Homo sapiens Ampicillin PMID:26780180 The gRNA was designed to target the following Genbank reference sequence(s): NM_199289.2. Note that this plasmid does NOT contain Cas9. It should be used in conjunction with lentiCas9-Blast (Addgene #52962) or otherwise with cell lines already expressing Cas9. Browse the full kinome gRNA library at http://www.addgene.org/pooled-library/broadgpp-human-kinome/ or visit http://www.broadinstitute.org/rnai/public/ for detailed protocols and information. Backbone Marker:Zhang Lab (Addgene plasmid # 52963); Vector Backbone:lentiGuide-Puro; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-29 01:10:31 0
MAST1 gRNA (BRDN0001149113)
 
Resource Report
Resource Website 		RRID:Addgene_76121 MAST1 Homo sapiens Ampicillin PMID:26780180 The gRNA was designed to target the following Genbank reference sequence(s): NM_014975.2. Note that this plasmid does NOT contain Cas9. It should be used in conjunction with lentiCas9-Blast (Addgene #52962) or otherwise with cell lines already expressing Cas9. Browse the full kinome gRNA library at http://www.addgene.org/pooled-library/broadgpp-human-kinome/ or visit http://www.broadinstitute.org/rnai/public/ for detailed protocols and information. Backbone Marker:Zhang Lab (Addgene plasmid # 52963); Vector Backbone:lentiGuide-Puro; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-29 01:10:31 0
NEK1 gRNA (BRDN0001145167)
 
Resource Report
Resource Website 		RRID:Addgene_76128 NEK1 Homo sapiens Ampicillin PMID:26780180 The gRNA was designed to target the following Genbank reference sequence(s): NM_001199397.1,NM_001199398.1,NM_001199399.1,NM_001199400.1,NM_012224.2. Note that this plasmid does NOT contain Cas9. It should be used in conjunction with lentiCas9-Blast (Addgene #52962) or otherwise with cell lines already expressing Cas9. Browse the full kinome gRNA library at http://www.addgene.org/pooled-library/broadgpp-human-kinome/ or visit http://www.broadinstitute.org/rnai/public/ for detailed protocols and information. Backbone Marker:Zhang Lab (Addgene plasmid # 52963); Vector Backbone:lentiGuide-Puro; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-29 01:10:32 0
MYT1 gRNA (BRDN0001147389)
 
Resource Report
Resource Website 		RRID:Addgene_76129 MYT1 Homo sapiens Ampicillin PMID:26780180 The gRNA was designed to target the following Genbank reference sequence(s): NM_004535.2. Note that this plasmid does NOT contain Cas9. It should be used in conjunction with lentiCas9-Blast (Addgene #52962) or otherwise with cell lines already expressing Cas9. Browse the full kinome gRNA library at http://www.addgene.org/pooled-library/broadgpp-human-kinome/ or visit http://www.broadinstitute.org/rnai/public/ for detailed protocols and information. Backbone Marker:Zhang Lab (Addgene plasmid # 52963); Vector Backbone:lentiGuide-Puro; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-29 01:10:31 0
pDGB1omega2_SF (GB0466)
 
Resource Report
Resource Website 		RRID:Addgene_68243 Solanum lycopersicum intergenic region Other Spectinomycin PMID:23669743 insert can be released with BsaI Backbone Marker:self-made; derived from pGreenII generated at the JIC; Vector Backbone:pDGB1_omega2; Vector Types:Synthetic Biology, Unspecified; Bacterial Resistance:Spectinomycin BsaI and BsmBI sites removed 2026-08-29 01:09:14 0
pDGB1omega1_SF (GB0158)
 
Resource Report
Resource Website 		RRID:Addgene_68242 Solanum lycopersicum intergenic region Other Spectinomycin PMID:23669743 insert can be released with BsaI Backbone Marker:self-made; derived from pGreenII generated at the JIC; Vector Backbone:pDGB1_omega1; Vector Types:Synthetic Biology, Unspecified; Bacterial Resistance:Spectinomycin BsaI and BsmBI sites removed 2026-08-29 01:09:14 0
pDGB3_omega2R
 
Resource Report
Resource Website 		RRID:Addgene_68241 empty vector Other Spectinomycin PMID:23669743 Backbone Marker:self-made; derived from pCambia1302 generated at the Cambia Institute; Vector Backbone:pDGB3_omega2R; Vector Types:Plant Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin 2026-08-29 01:09:14 0
pDGB3_omega1R
 
Resource Report
Resource Website 		RRID:Addgene_68240 empty vector Other Spectinomycin PMID:23669743 Backbone Marker:self-made; derived from pCambia1302 generated at the Cambia Institute; Vector Backbone:pDGB3_omega1R; Vector Types:Plant Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin 2026-08-29 01:09:14 0
pICSL11057
 
Resource Report
Resource Website 		RRID:Addgene_68253 Promote:TaU6+sgRNA HvPM19_1 Triticum aestivum (wheat) and synthetic Ampicillin PMID:26616834 Target seq: GCTCTCCACTCTGGGCTCTT Vector Backbone:pICH47761 (AddGene #48003); Vector Types:Plant Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-29 01:09:14 0
pICSL11055
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_68252 Promoter:2x35s+5'UTR:Omega+CDS:nptII+3'UTR/terminator:Nos Cauliflower Mosaic Virus, Tobacco Mosaic Virus, Escherichia coli and Agrobacterium tumefaciens Ampicillin PMID:26616834 Vector Backbone:pICH47732 (AddGene #48000); Vector Types:Plant Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-29 01:09:14 2
pICSL80036
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_68259 Coding sequence, hygromycin phophotransferase II (Escherichia coli) E. coli Spectinomycin PMID:26616834 Vector Backbone:pICH41308 AddGene #47998; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin 2026-08-29 01:09:15 1
pICSL12009
 
Resource Report
Resource Website 		RRID:Addgene_68257 Promoter and 5UTR Ubiquitin (Zea mays) Zea mays Spectinomycin PMID:26616834 Vector Backbone:pICH41295 AddGene #47997; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin 2026-08-29 01:09:15 0
pICSL11062
 
Resource Report
Resource Website 		RRID:Addgene_68256 Promoter_AtU6-26 + sgRNA_BolC.GA4a-2 Arabidopsis thaliana Ampicillin PMID:26616834 Target sequence: GTTGAGAGGGGAGCCGGTGA Vector Backbone:pICH47761 (AddGene #48003); Vector Types:Plant Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-29 01:09:15 0
pICSL90002
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_68261 Promoter: U6-26 (Arabidopsis thaliana) Arabidopsis thaliana Spectinomycin PMID:26616834 Vector Backbone:pAGM9121; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin 2026-08-29 01:09:15 6
pICSL80037
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_68260 Coding sequence, neomycin phophotransferase II (Escherichia coli) E. coli Spectinomycin PMID:26616834 Vector Backbone:pICH41308 AddGene #47998; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin 2026-08-29 01:09:15 1
0.22 hA33 luciferase
 
Resource Report
Resource Website 		RRID:Addgene_68157 A33 Homo sapiens Ampicillin PMID:12114523 Backbone Marker:Promega; Backbone Size:4800; Vector Backbone:pGL3 Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin starts at -222 relative to ATG 2026-08-29 01:09:14 0
pPAt2S3 (GB0029)
 
Resource Report
Resource Website 		RRID:Addgene_68162 At2S3 promoter Arabidopsis thaliana Ampicillin PMID:23669743 insert can be released with BsaI Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin BsaI and BsmBI sites removed 2026-08-29 01:09:14 0
pHygromycin (GB0211)
 
Resource Report
Resource Website 		RRID:Addgene_68204 Hygromycin resistance gene coding region Other Ampicillin PMID:23669743 insert can be released with BsaI Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin BsaI and BsmBI sites removed 2026-08-29 01:09:14 0
pGUS (GB0208)
 
Resource Report
Resource Website 		RRID:Addgene_68203 GUS coding region Other Ampicillin PMID:23669743 insert can be released with BsaI Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin BsaI and BsmBI sites removed 2026-08-29 01:09:14 0
pPTctp (GB0083)
 
Resource Report
Resource Website 		RRID:Addgene_68169 SlTCTP promoter Other Ampicillin PMID:23669743 insert can be released with BsaI Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin BsaI and BsmBI sites removed 2026-08-29 01:09:14 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

dkNET community events and announcements in August, 2026

HIRN Funding Opportunity: SPARKS Award

Join the Whole Person Physiome 1st Data Jamboree on August 24-25

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch