Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: NEK5
Vector Backbone Description: Backbone Marker:Zhang Lab (Addgene plasmid # 52963); Vector Backbone:lentiGuide-Puro; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26780180
Comments: The gRNA was designed to target the following Genbank reference sequence(s): NM_199289.2. Note that this plasmid does NOT contain Cas9. It should be used in conjunction with lentiCas9-Blast (Addgene #52962) or otherwise with cell lines already expressing Cas9. Browse the full kinome gRNA library at http://www.addgene.org/pooled-library/broadgpp-human-kinome/ or visit http://www.broadinstitute.org/rnai/public/ for detailed protocols and information.
Proper citation: RRID:Addgene_76120 Copy
Species: Homo sapiens
Genetic Insert: MAST1
Vector Backbone Description: Backbone Marker:Zhang Lab (Addgene plasmid # 52963); Vector Backbone:lentiGuide-Puro; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26780180
Comments: The gRNA was designed to target the following Genbank reference sequence(s): NM_014975.2. Note that this plasmid does NOT contain Cas9. It should be used in conjunction with lentiCas9-Blast (Addgene #52962) or otherwise with cell lines already expressing Cas9. Browse the full kinome gRNA library at http://www.addgene.org/pooled-library/broadgpp-human-kinome/ or visit http://www.broadinstitute.org/rnai/public/ for detailed protocols and information.
Proper citation: RRID:Addgene_76121 Copy
Species: Homo sapiens
Genetic Insert: NEK1
Vector Backbone Description: Backbone Marker:Zhang Lab (Addgene plasmid # 52963); Vector Backbone:lentiGuide-Puro; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26780180
Comments: The gRNA was designed to target the following Genbank reference sequence(s): NM_001199397.1,NM_001199398.1,NM_001199399.1,NM_001199400.1,NM_012224.2. Note that this plasmid does NOT contain Cas9. It should be used in conjunction with lentiCas9-Blast (Addgene #52962) or otherwise with cell lines already expressing Cas9. Browse the full kinome gRNA library at http://www.addgene.org/pooled-library/broadgpp-human-kinome/ or visit http://www.broadinstitute.org/rnai/public/ for detailed protocols and information.
Proper citation: RRID:Addgene_76128 Copy
Species: Homo sapiens
Genetic Insert: MYT1
Vector Backbone Description: Backbone Marker:Zhang Lab (Addgene plasmid # 52963); Vector Backbone:lentiGuide-Puro; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26780180
Comments: The gRNA was designed to target the following Genbank reference sequence(s): NM_004535.2. Note that this plasmid does NOT contain Cas9. It should be used in conjunction with lentiCas9-Blast (Addgene #52962) or otherwise with cell lines already expressing Cas9. Browse the full kinome gRNA library at http://www.addgene.org/pooled-library/broadgpp-human-kinome/ or visit http://www.broadinstitute.org/rnai/public/ for detailed protocols and information.
Proper citation: RRID:Addgene_76129 Copy
Species: Other
Genetic Insert: Solanum lycopersicum intergenic region
Vector Backbone Description: Backbone Marker:self-made; derived from pGreenII generated at the JIC; Vector Backbone:pDGB1_omega2; Vector Types:Synthetic Biology, Unspecified; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23669743
Comments: insert can be released with BsaI
Proper citation: RRID:Addgene_68243 Copy
Species: Other
Genetic Insert: Solanum lycopersicum intergenic region
Vector Backbone Description: Backbone Marker:self-made; derived from pGreenII generated at the JIC; Vector Backbone:pDGB1_omega1; Vector Types:Synthetic Biology, Unspecified; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23669743
Comments: insert can be released with BsaI
Proper citation: RRID:Addgene_68242 Copy
Species: Other
Genetic Insert: empty vector
Vector Backbone Description: Backbone Marker:self-made; derived from pCambia1302 generated at the Cambia Institute; Vector Backbone:pDGB3_omega2R; Vector Types:Plant Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23669743
Proper citation: RRID:Addgene_68241 Copy
Species: Other
Genetic Insert: empty vector
Vector Backbone Description: Backbone Marker:self-made; derived from pCambia1302 generated at the Cambia Institute; Vector Backbone:pDGB3_omega1R; Vector Types:Plant Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23669743
Proper citation: RRID:Addgene_68240 Copy
Species: Triticum aestivum (wheat) and synthetic
Genetic Insert: Promote:TaU6+sgRNA HvPM19_1
Vector Backbone Description: Vector Backbone:pICH47761 (AddGene #48003); Vector Types:Plant Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26616834
Comments: Target seq: GCTCTCCACTCTGGGCTCTT
Proper citation: RRID:Addgene_68253 Copy
Species: Cauliflower Mosaic Virus, Tobacco Mosaic Virus, Escherichia coli and Agrobacterium tumefaciens
Genetic Insert: Promoter:2x35s+5'UTR:Omega+CDS:nptII+3'UTR/terminator:Nos
Vector Backbone Description: Vector Backbone:pICH47732 (AddGene #48000); Vector Types:Plant Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26616834
Proper citation: RRID:Addgene_68252 Copy
Species: E. coli
Genetic Insert: Coding sequence, hygromycin phophotransferase II (Escherichia coli)
Vector Backbone Description: Vector Backbone:pICH41308 AddGene #47998; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:26616834
Proper citation: RRID:Addgene_68259 Copy
Species: Zea mays
Genetic Insert: Promoter and 5UTR Ubiquitin (Zea mays)
Vector Backbone Description: Vector Backbone:pICH41295 AddGene #47997; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:26616834
Proper citation: RRID:Addgene_68257 Copy
Species: Arabidopsis thaliana
Genetic Insert: Promoter_AtU6-26 + sgRNA_BolC.GA4a-2
Vector Backbone Description: Vector Backbone:pICH47761 (AddGene #48003); Vector Types:Plant Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26616834
Comments: Target sequence: GTTGAGAGGGGAGCCGGTGA
Proper citation: RRID:Addgene_68256 Copy
Species: Arabidopsis thaliana
Genetic Insert: Promoter: U6-26 (Arabidopsis thaliana)
Vector Backbone Description: Vector Backbone:pAGM9121; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:26616834
Proper citation: RRID:Addgene_68261 Copy
Species: E. coli
Genetic Insert: Coding sequence, neomycin phophotransferase II (Escherichia coli)
Vector Backbone Description: Vector Backbone:pICH41308 AddGene #47998; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:26616834
Proper citation: RRID:Addgene_68260 Copy
Species: Homo sapiens
Genetic Insert: A33
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4800; Vector Backbone:pGL3 Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12114523
Proper citation: RRID:Addgene_68157 Copy
Species: Arabidopsis thaliana
Genetic Insert: At2S3 promoter
Vector Backbone Description: Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23669743
Comments: insert can be released with BsaI
Proper citation: RRID:Addgene_68162 Copy
Species: Other
Genetic Insert: Hygromycin resistance gene coding region
Vector Backbone Description: Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23669743
Comments: insert can be released with BsaI
Proper citation: RRID:Addgene_68204 Copy
Species: Other
Genetic Insert: GUS coding region
Vector Backbone Description: Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23669743
Comments: insert can be released with BsaI
Proper citation: RRID:Addgene_68203 Copy
Species: Other
Genetic Insert: SlTCTP promoter
Vector Backbone Description: Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23669743
Comments: insert can be released with BsaI
Proper citation: RRID:Addgene_68169 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
