Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 28 showing 541 ~ 560 out of 1,737 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/195510

Species: E. Coli
Genetic Insert: Hygromycin
Vector Backbone Description: Backbone Size:7944; Vector Backbone:pCHA1.1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37561850

Proper citation: RRID:Addgene_195510 Copy   


  • RRID:Addgene_222724

http://www.addgene.org/222724

Species: E. coli
Genetic Insert: IS621 Recombinase
Vector Backbone Description: Vector Backbone:pNP561 - p15A Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:38926615
Comments: Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint.

Proper citation: RRID:Addgene_222724 Copy   


  • RRID:Addgene_222726

http://www.addgene.org/222726

Species: E. coli
Genetic Insert: IS621 bridge RNA
Vector Backbone Description: Vector Backbone:pNP555 - ColE1 Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38926615
Comments: Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint.

Proper citation: RRID:Addgene_222726 Copy   


  • RRID:Addgene_222728

http://www.addgene.org/222728

Species: E. coli
Genetic Insert: IS621 Recombinase
Vector Backbone Description: Vector Backbone:pNP561 - p15A Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:38926615
Comments: Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint.

Proper citation: RRID:Addgene_222728 Copy   


  • RRID:Addgene_222732

http://www.addgene.org/222732

Species: E. coli
Genetic Insert: IS621 Helper (WT)
Vector Backbone Description: Vector Backbone:pNP1950 - p15A Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:38926615
Comments: Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint.

Proper citation: RRID:Addgene_222732 Copy   


  • RRID:Addgene_222730

http://www.addgene.org/222730

Species: E. coli
Genetic Insert: IS621 bridge RNA
Vector Backbone Description: Vector Backbone:pNP1723 - ColE1 Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38926615
Comments: Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint.

Proper citation: RRID:Addgene_222730 Copy   


  • RRID:Addgene_220921

http://www.addgene.org/220921

Species: E. coli
Genetic Insert: Genotype: F’[traD36 lacIq lacZ ∆M15 proA+B+] glnV (supE) thi-1 ∆(mcrB-hsdSM)5 (rK- mK- McrB-) ∆(lac-proAB) ulaD::M13
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:38499480
Comments: Primers for validation Pair 1: agtaaggacgcgccatgaaa + agcgaaagacagcatcggaa (Ta = 59 C, should have 2526 bp product) Pair 2: aatcggttgaatgtcgccct + gggaaacgacgatgagcaga (Ta = 59, should have 3900 bp product)

Proper citation: RRID:Addgene_220921 Copy   


  • RRID:Addgene_146185

http://www.addgene.org/146185

Species: E. coli
Genetic Insert: CAT-PTC72
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12881430
Comments: Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.

Proper citation: RRID:Addgene_146185 Copy   


  • RRID:Addgene_146182

http://www.addgene.org/146182

Species: E. coli
Genetic Insert: CAT
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12881430
Comments: Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.

Proper citation: RRID:Addgene_146182 Copy   


  • RRID:Addgene_246058

http://www.addgene.org/246058

Species: E. coli
Genetic Insert: Red Fluorescent Protein
Vector Backbone Description: Vector Backbone:SC101; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:41034576
Comments: Please visit https://doi.org/10.1101/2025.03.28.646030 for the bioRxiv preprint.

Proper citation: RRID:Addgene_246058 Copy   


  • RRID:Addgene_246061

http://www.addgene.org/246061

Species: E. coli
Genetic Insert: 2TMbeta
Vector Backbone Description: Vector Backbone:SC101; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:41034576
Comments: Please visit https://doi.org/10.1101/2025.03.28.646030 for the bioRxiv preprint.

Proper citation: RRID:Addgene_246061 Copy   


  • RRID:Addgene_246073

http://www.addgene.org/246073

Species: E. coli
Genetic Insert: 2TMbeta
Vector Backbone Description: Vector Backbone:pET-Duet1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41034576
Comments: Please visit https://doi.org/10.1101/2025.03.28.646030 for the bioRxiv preprint.

Proper citation: RRID:Addgene_246073 Copy   


  • RRID:Addgene_232487

http://www.addgene.org/232487

Species: E. coli
Genetic Insert: YebST
Vector Backbone Description: Vector Backbone:pET17b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41565823
Comments: Please visit https://doi.org/10.1101/2025.03.21.644421 for bioRxiv preprint.

Proper citation: RRID:Addgene_232487 Copy   


  • RRID:Addgene_232511

http://www.addgene.org/232511

Species: E. coli
Genetic Insert: YebST
Vector Backbone Description: Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41565823
Comments: Please visit https://doi.org/10.1101/2025.03.21.644421 for bioRxiv preprint.

Proper citation: RRID:Addgene_232511 Copy   


  • RRID:Addgene_232492

http://www.addgene.org/232492

Species: E. coli
Genetic Insert: YebST
Vector Backbone Description: Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41565823
Comments: Please visit https://doi.org/10.1101/2025.03.21.644421 for bioRxiv preprint.

Proper citation: RRID:Addgene_232492 Copy   


  • RRID:Addgene_232493

http://www.addgene.org/232493

Species: E. coli
Genetic Insert: YebST
Vector Backbone Description: Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41565823
Comments: Please visit https://doi.org/10.1101/2025.03.21.644421 for bioRxiv preprint.

Proper citation: RRID:Addgene_232493 Copy   


  • RRID:Addgene_232494

http://www.addgene.org/232494

Species: E. coli
Genetic Insert: YebST
Vector Backbone Description: Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41565823
Comments: Please visit https://doi.org/10.1101/2025.03.21.644421 for bioRxiv preprint.

Proper citation: RRID:Addgene_232494 Copy   


  • RRID:Addgene_232491

http://www.addgene.org/232491

Species: E. coli
Genetic Insert: YebST
Vector Backbone Description: Vector Backbone:pET17b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41565823
Comments: Please visit https://doi.org/10.1101/2025.03.21.644421 for bioRxiv preprint.

Proper citation: RRID:Addgene_232491 Copy   


  • RRID:Addgene_232498

http://www.addgene.org/232498

Species: E. coli
Genetic Insert: YebST
Vector Backbone Description: Vector Backbone:pET17b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41565823
Comments: Please visit https://doi.org/10.1101/2025.03.21.644421 for bioRxiv preprint.

Proper citation: RRID:Addgene_232498 Copy   


  • RRID:Addgene_232508

http://www.addgene.org/232508

Species: E. coli
Genetic Insert: YebT
Vector Backbone Description: Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41565823
Comments: Please visit https://doi.org/10.1101/2025.03.21.644421 for bioRxiv preprint.

Proper citation: RRID:Addgene_232508 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X