Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: E. Coli
Genetic Insert: Hygromycin
Vector Backbone Description: Backbone Size:7944; Vector Backbone:pCHA1.1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37561850
Proper citation: RRID:Addgene_195510 Copy
Species: E. coli
Genetic Insert: IS621 Recombinase
Vector Backbone Description: Vector Backbone:pNP561 - p15A Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:38926615
Comments: Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint.
Proper citation: RRID:Addgene_222724 Copy
Species: E. coli
Genetic Insert: IS621 bridge RNA
Vector Backbone Description: Vector Backbone:pNP555 - ColE1 Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38926615
Comments: Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint.
Proper citation: RRID:Addgene_222726 Copy
Species: E. coli
Genetic Insert: IS621 Recombinase
Vector Backbone Description: Vector Backbone:pNP561 - p15A Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:38926615
Comments: Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint.
Proper citation: RRID:Addgene_222728 Copy
Species: E. coli
Genetic Insert: IS621 Helper (WT)
Vector Backbone Description: Vector Backbone:pNP1950 - p15A Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:38926615
Comments: Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint.
Proper citation: RRID:Addgene_222732 Copy
Species: E. coli
Genetic Insert: IS621 bridge RNA
Vector Backbone Description: Vector Backbone:pNP1723 - ColE1 Ori; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38926615
Comments: Please visit https://doi.org/10.1101/2024.01.24.577089 for bioRxiv preprint.
Proper citation: RRID:Addgene_222730 Copy
Species: E. coli
Genetic Insert: Genotype: F’[traD36 lacIq lacZ ∆M15 proA+B+] glnV (supE) thi-1 ∆(mcrB-hsdSM)5 (rK- mK- McrB-) ∆(lac-proAB) ulaD::M13
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:38499480
Comments: Primers for validation
Pair 1: agtaaggacgcgccatgaaa + agcgaaagacagcatcggaa (Ta = 59 C, should have 2526 bp product)
Pair 2: aatcggttgaatgtcgccct + gggaaacgacgatgagcaga (Ta = 59, should have 3900 bp product)
Proper citation: RRID:Addgene_220921 Copy
Species: E. coli
Genetic Insert: CAT-PTC72
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12881430
Comments: Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_146185 Copy
Species: E. coli
Genetic Insert: CAT
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12881430
Comments: Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_146182 Copy
Species: E. coli
Genetic Insert: Red Fluorescent Protein
Vector Backbone Description: Vector Backbone:SC101; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:41034576
Comments: Please visit https://doi.org/10.1101/2025.03.28.646030 for the bioRxiv preprint.
Proper citation: RRID:Addgene_246058 Copy
Species: E. coli
Genetic Insert: 2TMbeta
Vector Backbone Description: Vector Backbone:SC101; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:41034576
Comments: Please visit https://doi.org/10.1101/2025.03.28.646030 for the bioRxiv preprint.
Proper citation: RRID:Addgene_246061 Copy
Species: E. coli
Genetic Insert: 2TMbeta
Vector Backbone Description: Vector Backbone:pET-Duet1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41034576
Comments: Please visit https://doi.org/10.1101/2025.03.28.646030 for the bioRxiv preprint.
Proper citation: RRID:Addgene_246073 Copy
Species: E. coli
Genetic Insert: YebST
Vector Backbone Description: Vector Backbone:pET17b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41565823
Comments: Please visit https://doi.org/10.1101/2025.03.21.644421 for bioRxiv preprint.
Proper citation: RRID:Addgene_232487 Copy
Species: E. coli
Genetic Insert: YebST
Vector Backbone Description: Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41565823
Comments: Please visit https://doi.org/10.1101/2025.03.21.644421 for bioRxiv preprint.
Proper citation: RRID:Addgene_232511 Copy
Species: E. coli
Genetic Insert: YebST
Vector Backbone Description: Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41565823
Comments: Please visit https://doi.org/10.1101/2025.03.21.644421 for bioRxiv preprint.
Proper citation: RRID:Addgene_232492 Copy
Species: E. coli
Genetic Insert: YebST
Vector Backbone Description: Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41565823
Comments: Please visit https://doi.org/10.1101/2025.03.21.644421 for bioRxiv preprint.
Proper citation: RRID:Addgene_232493 Copy
Species: E. coli
Genetic Insert: YebST
Vector Backbone Description: Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41565823
Comments: Please visit https://doi.org/10.1101/2025.03.21.644421 for bioRxiv preprint.
Proper citation: RRID:Addgene_232494 Copy
Species: E. coli
Genetic Insert: YebST
Vector Backbone Description: Vector Backbone:pET17b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41565823
Comments: Please visit https://doi.org/10.1101/2025.03.21.644421 for bioRxiv preprint.
Proper citation: RRID:Addgene_232491 Copy
Species: E. coli
Genetic Insert: YebST
Vector Backbone Description: Vector Backbone:pET17b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41565823
Comments: Please visit https://doi.org/10.1101/2025.03.21.644421 for bioRxiv preprint.
Proper citation: RRID:Addgene_232498 Copy
Species: E. coli
Genetic Insert: YebT
Vector Backbone Description: Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41565823
Comments: Please visit https://doi.org/10.1101/2025.03.21.644421 for bioRxiv preprint.
Proper citation: RRID:Addgene_232508 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.