Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pET His6 Sumo TEV co-transformation cloning vector (13S-S) Resource Report Resource Website 1+ mentions |
RRID:Addgene_48329 | Spectinomycin | This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV cleavable His6-Sumo fusion tag on the N-terminus and a Spec resistance. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. The 13-series vectors were designed to enable rapid cloning for a co-expression system. Vectors are based on Novagen's Duet system. Each gene is expressed on its own vector, which has been optimized so that each gene expresses at approximately equal levels. The 13-series vectors are all compatible with 2-series transfer vectors, so if cotransformation fails, there is a readily available backup in polycistronic expression.13S CDF origin SpecR13K ColA origin KanR2-series transfer ColE1 origin AmpR13S vectors must be cotransformed with a 2-series vector for optimal expression (that is, the presence of an empty 2A-T vector enhances expression of a gene in 13S). For triple expressions, the proteins all seem to express at approximately equal levels. Genes in the CDF vector consistently express at very slightly lower levels, so if you're trying to pull down stoichiometric complexes, it's probably best to put His6-fusion protein in this vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:3939; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin | 2026-08-15 01:15:49 | 1 | ||||
|
pET His6 Mocr TEV co-transformation cloning vector (13S-O) Resource Report Resource Website |
RRID:Addgene_48327 | Spectinomycin | This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV cleavable His6-Mocr fusion tag on the N-terminus and a Spec resistance. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. The 13-series vectors were designed to enable rapid cloning for a co-expression system. Vectors are based on Novagen's Duet system. Each gene is expressed on its own vector, which has been optimized so that each gene expresses at approximately equal levels. The 13-series vectors are all compatible with 2-series transfer vectors, so if cotransformation fails, there is a readily available backup in polycistronic expression. 13S CDF origin SpecR13K ColA origin KanR2-series transfer ColE1 origin AmpR13S vectors must be cotransformed with a 2-series vector for optimal expression (that is, the presence of an empty 2A-T vector enhances expression of a gene in 13S). For triple expressions, the proteins all seem to express at approximately equal levels. Genes in the CDF vector consistently express at very slightly lower levels, so if you're trying to pull down stoichiometric complexes, it's probably best to put His6-fusion protein in this vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:3990; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin | 2026-08-15 01:15:49 | 0 | ||||
|
pET StrepII TEV co-transformation cloning vector (13S-R) Resource Report Resource Website 1+ mentions |
RRID:Addgene_48328 | Spectinomycin | This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV cleavable StrepII fusion tag on the N-terminus and a Spec resistance. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. The 13-series vectors were designed to enable rapid cloning for a co-expression system. Vectors are based on Novagen's Duet system. Each gene is expressed on its own vector, which has been optimized so that each gene expresses at approximately equal levels. The 13-series vectors are all compatible with 2-series transfer vectors, so if cotransformation fails, there is a readily available backup in polycistronic expression. 13S CDF origin SpecR13K ColA origin KanR2-series transfer ColE1 origin AmpR13S vectors must be cotransformed with a 2-series vector for optimal expression (that is, the presence of an empty 2A-T vector enhances expression of a gene in 13S). For triple expressions, the proteins all seem to express at approximately equal levels. Genes in the CDF vector consistently express at very slightly lower levels, so if you're trying to pull down stoichiometric complexes, it's probably best to put His6-fusion protein in this vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:3630; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin | 2026-08-15 01:15:49 | 4 | ||||
|
pBAD empty polycistronic destination vector (8D) Resource Report Resource Website |
RRID:Addgene_48282 | Ampicillin | This plasmid is an empty destination vector. It is a polycistronic vector that can express up to five genes at once. Genes must first be cloned into any of our 8-series transfer vectors (8BT,8CT,8UT), then subcloned into any of the five cassettes of the destination vector: Cassette 1: BamHI/XbaI Cassette 2: AsiSI/PspXI Cassette 3: SbfI/AscI Cassette 4: AdeI/NotI Cassette 5: PacI/FseI Please note that you must always insert your gene into the lowest cassette number first (e.g., if you're using cassettes 2 and 3, you must put your gene into cassette 2 first, then move on to cassette 3). You do not have to use all of the cassettes. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:5767; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:49 | 0 | ||||
|
pET LIC cloning vector with BioBrick polycistronic restriction sites (9A) Resource Report Resource Website |
RRID:Addgene_48283 | Ampicillin | This plasmid is an empty vector to be used with a LIC cloning protocol. To clone into this vector, add LIC version 2 fusion tags to the 5' end of your PCR primers. Forward - 5'TTTAAGAAGGAGATATAGATC3' Reverse - 5'TTATGGAGTTGGGATCTTATTA3'In addition, ensure that your open reading frame contains an ATG start codon. Linearize the plasmid with EcoRV and gel purify. When digesting the DNA with T4 polymerase for LIC version 2, use dGTP for insert and dCTP for vector. Series 9 vectors have BioBrick restriction sites to facilitate subcloning reactions to make polycistronic expression vectors. NotI, PacI, AsiSI, and SbfI are the restriction enzyme sites that flank your open reading frame. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:4710; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:49 | 0 | ||||
|
pET FLAG TEV cloning vector with BioBrick polycistronic restriction sites (9L) Resource Report Resource Website |
RRID:Addgene_48288 | Ampicillin | This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV cleavable FLAG fusion tag on the N-terminus. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. Series 9 vectors have BioBrick restriction sites to facilitate subcloning reactions to make polycistronic expression vectors. NotI, PacI, AsiSI, and SbfI are the restriction enzyme sites that flank your open reading frame. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:4762; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:49 | 0 | ||||
|
pET His6 Sumo TEV co-transformation cloning vector (13K-S) Resource Report Resource Website |
RRID:Addgene_48321 | Kanamycin | This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV cleavable His6-Sumo fusion tag on the N-terminus and a Kan resistance. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. The 13-series vectors were designed to enable rapid cloning for a co-expression system. Vectors are based on Novagen's Duet system. Each gene is expressed on its own vector, which has been optimized so that each gene expresses at approximately equal levels. The 13-series vectors are all compatible with 2-series transfer vectors, so if cotransformation fails, there is a readily available backup in polycistronic expression. 13S CDF origin SpecR13K ColA origin KanR2-series transfer ColE1 origin AmpR13S vectors must be cotransformed with a 2-series vector for optimal expression (that is, the presence of an empty 2A-T vector enhances expression of a gene in 13S). For triple expressions, the proteins all seem to express at approximately equal levels. Genes in the CDF vector consistently express at very slightly lower levels, so if you're trying to pull down stoichiometric complexes, it's probably best to put His6-fusion protein in this vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:3885; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:49 | 0 | ||||
|
pET His6 Mocr TEV cloning vector with BioBrick polycistronic restriction sites (9O) Resource Report Resource Website |
RRID:Addgene_48289 | Ampicillin | This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV cleavable His6-Mocr fusion tag on the N-terminus. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. Series 9 vectors have BioBrick restriction sites to facilitate subcloning reactions to make polycistronic expression vectors. NotI, PacI, AsiSI, and SbfI are the restriction enzyme sites that flank your open reading frame. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:5134; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:49 | 0 | ||||
|
pET His6 Thioredoxin TEV co-transformation cloning vector (13K-T) Resource Report Resource Website |
RRID:Addgene_48322 | Kanamycin | This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV cleavable His6-Thioredoxin fusion tag on the N-terminus and a Kan resistance. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. The 13-series vectors were designed to enable rapid cloning for a co-expression system. Vectors are based on Novagen's Duet system. Each gene is expressed on its own vector, which has been optimized so that each gene expresses at approximately equal levels. The 13-series vectors are all compatible with 2-series transfer vectors, so if cotransformation fails, there is a readily available backup in polycistronic expression. 13S CDF origin SpecR13K ColA origin KanR2-series transfer ColE1 origin AmpR13S vectors must be cotransformed with a 2-series vector for optimal expression (that is, the presence of an empty 2A-T vector enhances expression of a gene in 13S). For triple expressions, the proteins all seem to express at approximately equal levels. Genes in the CDF vector consistently express at very slightly lower levels, so if you're trying to pull down stoichiometric complexes, it's probably best to put His6-fusion protein in this vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:3912; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:49 | 0 | ||||
|
pET His6 msfGFP TEV cloning vector with BioBrick polycistronic restriction sites (9GFP) Resource Report Resource Website 1+ mentions |
RRID:Addgene_48287 | Ampicillin | This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV cleavable His6-msfGFP fusion tag on the N-terminus. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. Series 9 vectors have BioBrick restriction sites to facilitate subcloning reactions to make polycistronic expression vectors. NotI, PacI, AsiSI, and SbfI are the restriction enzyme sites that flank your open reading frame. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:5497; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:49 | 4 | ||||
|
pBAD His6 MBP TEV LIC transfer vector (8CT) Resource Report Resource Website |
RRID:Addgene_48280 | Ampicillin | This plasmid is an empty vector. Your gene can be inserted via LIC cloning. 8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases. 8CT adds a TEV-cleavable His6-MBP tag to the N-terminus of your protein. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.This vector is a transfer vector that can be used in conjunction with the 8D destination vector to create a polycistronic construct. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:6906; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:48 | 0 | ||||
|
pBAD MYFQSNA LIC transfer vector (8UT) Resource Report Resource Website |
RRID:Addgene_48281 | Ampicillin | This plasmid is an empty vector. Your gene can be inserted via LIC cloning. 8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases. 8UT adds a MYFQSNA tag to the N-terminus of your protein. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. This vector is a transfer vector that can be used in conjunction with the 8D destination vector to create a polycistronic construct. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ Note: The plasmid as it is provided enocdes "MYFQSNI". However, the vector is supposed to be cut with SspI (AATATT), which is a blunt cutter that cuts between the N and the "I" (this ends up not being transcribed, however). Then, provided you use the LIC tags on your PCR primers that we've suggested, the forward primer will introduce an A residue immediately downstream of the N. The final tag, therefore, is MYFQSNA. | Backbone Size:5706; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:49 | 0 | ||||
|
pET Mocr TEV expression vector with BioBrick polypromoter restriction sites (14-W) Resource Report Resource Website |
RRID:Addgene_48315 | Ampicillin | This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV cleavable Mocr tag on the N-terminus and Amp resistance. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. The Series-14 plasmids were designed to overcome the unpredictable expression patterns of genes from a polycistronic message. As mentioned in the Series-2 and Series-9 polycistronic sections, often genes that express well from a single gene mRNA do not express at the same level when placed in a polycistronic message next to other genes. This effect is likely due to mRNA structure interfering with access to the ribosome binding site. When we first made our polypromoter plasmids we found that we could clone multiple genes together in the Xl1-Blue cells so that each possess a T7 promoter, followed by a Lac operator, followed by a ribosome binding site, followed by your open reading frame (T7-LacO-RBS-yORF). However, these multi-gene polypromoter plasmids were unable to be transformed into an expression strain such as BL-21 or Rosetta2. We then figured out that we needed a RecAexpression strain (like Rosetta-Blues) to successfully propagate our polypromoter plasmids. Although Rosetta-Blue cells propagated our plasmids, expression was not so great and we didn't want to rely on a specialized strain to perform our expression. Finally, we figured out that it was the LacO that follows the T7 promoter that was causing plasmid instability in our polypromoter system. Removal of the LacO allowed us to express our polypromoter plasmids in Rosetta2 cells and we have had much success with these plasmids since. Much like our Series- 2 plasmids, the Series-14 plasmids are going to give a substantial amount of leaky expression. However, even with this shortcoming, we have found Series-14 to be a valuable resource for expressing multi-protein complexes. Cloning into the Series-14 plasmids and subsequent biobrick subcloning is performed exactly as described for the Series-9 plasmids. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:3413; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:49 | 0 | ||||
|
pBAD His6 TEV LIC transfer vector (8BT) Resource Report Resource Website |
RRID:Addgene_48279 | Ampicillin | This plasmid is an empty vector. Your gene can be inserted via LIC cloning. 8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases.8BT adds a TEV-cleavable His6 tag to the N-terminus of your protein. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify.When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. This vector is a transfer vector that can be used in conjunction with the 8D destination vector to create a polycistronic construct. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:5742; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:49 | 0 | ||||
|
pET StrepII TEV expression vector with BioBrick polypromoter restriction sites (14-R) Resource Report Resource Website |
RRID:Addgene_48312 | Ampicillin | This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV cleavable StrepII tag on the N-terminus and Amp resistance. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. The Series-14 plasmids were designed to overcome the unpredictable expression patterns of genes from a polycistronic message. As mentioned in the Series-2 and Series-9 polycistronic sections, often genes that express well from a single gene mRNA do not express at the same level when placed in a polycistronic message next to other genes. This effect is likely due to mRNA structure interfering with access to the ribosome binding site. When we first made our polypromoter plasmids we found that we could clone multiple genes together in the Xl1-Blue cells so that each possess a T7 promoter, followed by a Lac operator, followed by a ribosome binding site, followed by your open reading frame (T7-LacO-RBS-yORF). However, these multi-gene polypromoter plasmids were unable to be transformed into an expression strain such as BL-21 or Rosetta2. We then figured out that we needed a RecAexpression strain (like Rosetta-Blues) to successfully propagate our polypromoter plasmids. Although Rosetta-Blue cells propagated our plasmids, expression was not so great and we didn't want to rely on a specialized strain to perform our expression. Finally, we figured out that it was the LacO that follows the T7 promoter that was causing plasmid instability in our polypromoter system. Removal of the LacO allowed us to express our polypromoter plasmids in Rosetta2 cells and we have had much success with these plasmids since. Much like our Series- 2 plasmids, the Series-14 plasmids are going to give a substantial amount of leaky expression. However, even with this shortcoming, we have found Series-14 to be a valuable resource for expressing multi-protein complexes. Cloning into the Series-14 plasmids and subsequent biobrick subcloning is performed exactly as described for the Series-9 plasmids. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:3071; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:49 | 0 | ||||
|
pET His6 Sumo TEV expression vector with BioBrick polypromoter restriction sites (14-S) Resource Report Resource Website 1+ mentions |
RRID:Addgene_48313 | Ampicillin | This plasmid is an empty vector to be used with a LIC cloning protocol.It has a TEV cleavable His6 Sumo tag on the N-terminus and Amp resistance. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. The Series-14 plasmids were designed to overcome the unpredictable expression patterns of genes from a polycistronic message. As mentioned in the Series-2 and Series-9 polycistronic sections, often genes that express well from a single gene mRNA do not express at the same level when placed in a polycistronic message next to other genes. This effect is likely due to mRNA structure interfering with access to the ribosome binding site. When we first made our polypromoter plasmids we found that we could clone multiple genes together in the Xl1-Blue cells so that each possess a T7 promoter, followed by a Lac operator, followed by a ribosome binding site, followed by your open reading frame (T7-LacO-RBS-yORF). However, these multi-gene polypromoter plasmids were unable to be transformed into an expression strain such as BL-21 or Rosetta2. We then figured out that we needed a RecAexpression strain (like Rosetta-Blues) to successfully propagate our polypromoter plasmids. Although Rosetta-Blue cells propagated our plasmids, expression was not so great and we didn't want to rely on a specialized strain to perform our expression. Finally, we figured out that it was the LacO that follows the T7 promoter that was causing plasmid instability in our polypromoter system. Removal of the LacO allowed us to express our polypromoter plasmids in Rosetta2 cells and we have had much success with these plasmids since. Much like our Series- 2 plasmids, the Series-14 plasmids are going to give a substantial amount of leaky expression. However, even with this shortcoming, we have found Series-14 to be a valuable resource for expressing multi-protein complexes. Cloning into the Series-14 plasmids and subsequent biobrick subcloning is performed exactly as described for the Series-9 plasmids. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:3371; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:49 | 1 | ||||
|
pET His6 StrepII TEV co-transformation cloning vector (13K-HR) Resource Report Resource Website 1+ mentions |
RRID:Addgene_48318 | Kanamycin | This plasmid is an empty vector to be used with a LIC cloning protocol.It has a TEV cleavable His6-StrepII fusion tag on the N-terminus and a Kan resistance. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. The 13-series vectors were designed to enable rapid cloning for a co-expression system. Vectors are based on Novagen's Duet system. Each gene is expressed on its own vector, which has been optimized so that each gene expresses at approximately equal levels. The 13-series vectors are all compatible with 2-series transfer vectors, so if cotransformation fails, there is a readily available backup in polycistronic expression. 13S CDF origin SpecR13K ColA origin KanR2-series transfer ColE1 origin AmpR13S vectors must be cotransformed with a 2-series vector for optimal expression (that is, the presence of an empty 2A-T vector enhances expression of a gene in 13S). For triple expressions, the proteins all seem to express at approximately equal levels. Genes in the CDF vector consistently express at very slightly lower levels, so if you're trying to pull down stoichiometric complexes, it's probably best to put His6-fusion protein in this vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:3612; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:49 | 6 | ||||
|
pET StrepII TEV co-transformation cloning vector (13K-R) Resource Report Resource Website 1+ mentions |
RRID:Addgene_48319 | Kanamycin | This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV cleavable StrepII fusion tag on the N-terminus and a Kan resistance. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. The 13-series vectors were designed to enable rapid cloning for a co-expression system. Vectors are based on Novagen's Duet system. Each gene is expressed on its own vector, which has been optimized so that each gene expresses at approximately equal levels. The 13-series vectors are all compatible with 2-series transfer vectors, so if cotransformation fails, there is a readily available backup in polycistronic expression. 13S CDF origin SpecR13K ColA origin KanR2-series transfer ColE1 origin AmpR13S vectors must be cotransformed with a 2-series vector for optimal expression (that is, the presence of an empty 2A-T vector enhances expression of a gene in 13S). For triple expressions, the proteins all seem to express at approximately equal levels. Genes in the CDF vector consistently express at very slightly lower levels, so if you're trying to pull down stoichiometric complexes, it's probably best to put His6-fusion protein in this vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:3576; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:49 | 9 | ||||
|
pET His6 MBP TEV co-transformation cloning vector (13K-C) Resource Report Resource Website |
RRID:Addgene_48317 | Kanamycin | This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV cleavable His6-MBP fusion tag on the N-terminus and a Kan resistance. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. The 13-series vectors were designed to enable rapid cloning for a co-expression system. Vectors are based on Novagen's Duet system. Each gene is expressed on its own vector, which has been optimized so that each gene expresses at approximately equal levels. The 13-series vectors are all compatible with 2-series transfer vectors, so if cotransformation fails, there is a readily available backup in polycistronic expression. 13S CDF origin SpecR13K ColA origin KanR2-series transfer ColE1 origin AmpR13S vectors must be cotransformed with a 2-series vector for optimal expression (that is, the presence of an empty 2A-T vector enhances expression of a gene in 13S). For triple expressions, the proteins all seem to express at approximately equal levels. Genes in the CDF vector consistently express at very slightly lower levels, so if you're trying to pull down stoichiometric complexes, it's probably best to put His6-fusion protein in this vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:4731; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:49 | 0 | ||||
|
pET His6 Mocr TEV expression vector with BioBrick polypromoter restriction sites (14-O) Resource Report Resource Website |
RRID:Addgene_48310 | Ampicillin | This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV cleavable His6-Mocr tag on the N-terminus and Amp resistance. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. The Series-14 plasmids were designed to overcome the unpredictable expression patterns of genes from a polycistronic message. As mentioned in the Series-2 and Series-9 polycistronic sections, often genes that express well from a single gene mRNA do not express at the same level when placed in a polycistronic message next to other genes. This effect is likely due to mRNA structure interfering with access to the ribosome binding site. When we first made our polypromoter plasmids we found that we could clone multiple genes together in the Xl1-Blue cells so that each possess a T7 promoter, followed by a Lac operator, followed by a ribosome binding site, followed by your open reading frame (T7-LacO-RBS-yORF). However, these multi-gene polypromoter plasmids were unable to be transformed into an expression strain such as BL-21 or Rosetta2. We then figured out that we needed a RecAexpression strain (like Rosetta-Blues) to successfully propagate our polypromoter plasmids. Although Rosetta-Blue cells propagated our plasmids, expression was not so great and we didn't want to rely on a specialized strain to perform our expression. Finally, we figured out that it was the LacO that follows the T7 promoter that was causing plasmid instability in our polypromoter system. Removal of the LacO allowed us to express our polypromoter plasmids in Rosetta2 cells and we have had much success with these plasmids since. Much like our Series- 2 plasmids, the Series-14 plasmids are going to give a substantial amount of leaky expression. However, even with this shortcoming, we have found Series-14 to be a valuable resource for expressing multi-protein complexes. Cloning into the Series-14 plasmids and subsequent biobrick subcloning is performed exactly as described for the Series-9 plasmids. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:3430; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:49 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.