Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

740,584 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pLKO.1-puro U6 sgRNA Oct4A -12
 
Resource Report
Resource Website 		RRID:Addgene_50921 Oct4A -12 sgRNA Homo sapiens Ampicillin PMID:24346702 gRNA target sequence GTGGGACTGGGGAGGGAGAG Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:16:12 0
pLKO.1-puro U6 sgRNA SOX17 -91
 
Resource Report
Resource Website 		RRID:Addgene_50923 Sox17 -91 sgRNA Homo sapiens Ampicillin PMID:24346702 gRNA target sequence GGGCGTGGGCCTAACGACGC Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:16:10 0
pLKO.1-puro U6 sgRNA Oct4A -158
 
Resource Report
Resource Website 		RRID:Addgene_50922 Oct4A -158 sgRNA Homo sapiens Ampicillin PMID:24346702 gRNA target sequence GGGGCGCCAGTTGTGTCTCC Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:16:10 0
pcDNA3.1 Flag YFP hNKCC1 I730C (NT504)
 
Resource Report
Resource Website 		RRID:Addgene_50884 human NKCC1 (synthetic) Homo sapiens Ampicillin PMID:24451383 Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin I730C in hNKCC1 in NT17 2026-08-15 01:16:09 0
pRGE31
 
Resource Report
Resource Website 		RRID:Addgene_50929 Ampicillin PMID:23956122 Please use the reference links above to access a published protocol for using plasmids pRGE31, pRGEB31, pRGE32 and pRGEB32 as well as a CRISPR design software tool. Backbone Marker:Nakagawa,T.; Backbone Size:6034; Vector Backbone:pUGW11; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:16:10 0
pLKO.1-puro U6 sgRNA SOX17 -177
 
Resource Report
Resource Website 		RRID:Addgene_50925 Sox17 -177 sgRNA Homo sapiens Ampicillin PMID:24346702 gRNA target sequence GCTCCGGCTAGTTTTCCCGG Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:16:10 0
pLKO.1-puro U6 sgRNA CAG
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_50927 negative control sgRNA synthetic Ampicillin PMID:24346702 Please note that Addgene's diagnostic digest results suggest that the backbone may be longer than suggested. Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:16:13 4
pLKO.1-puro U6 sgRNA SOX17 -296
 
Resource Report
Resource Website 		RRID:Addgene_50926 Sox17-296 sgRNA Homo sapiens Ampicillin PMID:24346702 gRNA target sequence GGGCAAGTACGTCGATTCCA Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:16:10 0
pcDNA3.1 Flag YFP hNKCC1 Y739C (NT525)
 
Resource Report
Resource Website 		RRID:Addgene_50893 human NKCC1 (synthetic) Homo sapiens Ampicillin Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Y739C in hNKCC1 in NT17 2026-08-15 01:16:09 0
pcDNA3.1 Flag YFP hNKCC1 A720C C723S C724V (NT534)
 
Resource Report
Resource Website 		RRID:Addgene_50899 human NKCC1 (synthetic) Homo sapiens Ampicillin Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin A720C C723S C724V in hNKCC1 in NT17 2026-08-15 01:16:09 0
p14-9VN9-3A
 
Resource Report
Resource Website 		RRID:Addgene_50932 SRP14 and SRP9 Homo sapiens Ampicillin Backbone Marker:Chang-Deng Hu (Addgene Plasmid# 22010); Backbone Size:5216; Vector Backbone:pBiFC-VN173; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Amino acids 60, 61 and 64 of SRP9 changed to alanine 2026-08-15 01:16:10 0
pscAluYNF1
 
Resource Report
Resource Website 		RRID:Addgene_50934 scAluYNF1 Homo sapiens Ampicillin PMID:25697503 Backbone Marker:Dewannieux,M., Esnault,C. and Heidmann,T. (2003) LINE-mediated retrotransposition of marked Alu sequences. Nat. Genet., 35, 41-4; Backbone Size:2773; Vector Backbone:pAlu-NeoTet; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin the poly(A) linker and the right arm of the dimeric ALuYNF1 gene were removed 2026-08-15 01:16:13 0
pAluYNF1
 
Resource Report
Resource Website 		RRID:Addgene_50933 AluYNF1 Homo sapiens Ampicillin PMID:25697503 Backbone Marker:Dewannieux,M., Esnault,C. and Heidmann,T. (2003) LINE-mediated retrotransposition of marked Alu sequences. Nat. Genet., 35, 41-4; Backbone Size:2773; Vector Backbone:pAlu-NeoTet; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:10 0
pcDNA3.1 Flag YFP hNKCC1 V740C (NT526)
 
Resource Report
Resource Website 		RRID:Addgene_50894 human NKCC1 (synthetic) Homo sapiens Ampicillin Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin V740C in hNKCC1 in NT17 2026-08-15 01:16:12 0
pcDNA3.1 Flag YFP hNKCC1 L718C C723S C724V (NT532)
 
Resource Report
Resource Website 		RRID:Addgene_50897 human NKCC1 (synthetic) Homo sapiens Ampicillin Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin L718C C723S C724V in hNKCC1 in NT17 2026-08-15 01:16:12 0
pcDNA3.1 Flag YFP hNKCC1 L717C C723S C724V (NT531)
 
Resource Report
Resource Website 		RRID:Addgene_50896 human NKCC1 (synthetic) Homo sapiens Ampicillin Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin L717C C723S C724V in hNKCC1 in NT17 2026-08-15 01:16:09 0
pET11a-hRanGAP1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_50941 RanGTPase activating protein 1 Homo sapiens Ampicillin PMID:22464730 Backbone Marker:Novagen; Backbone Size:5677; Vector Backbone:pET11a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:10 1
pHR SFFVp PHAkt Cerulean
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_50837 PHAkt Ampicillin PMID:21909100 Vector Backbone:pHR; Vector Types:Lentiviral, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:16:11 2
pHR SFFVp Phy-mCherry-CAAX
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_50839 PhyB 1-908 Arabidopsis thaliana Ampicillin PMID:21909100 Please note this plasmid is a crucial component of the system described in this additional reference: Toettcher JE, Weiner OD, Lim WA, Cell. 2013 Dec 5;155(6):1422-34. doi: 10.1016/j.cell.2013.11.004. (PMID 24315106) Vector Backbone:pHR; Vector Types:Lentiviral, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:16:09 4
pRBBm59
 
Resource Report
Resource Website 		RRID:Addgene_48115 promoter sacB - gfp Ampicillin PMID:17692983 Backbone Marker:Malten et al., 2005; Vector Backbone:pMM1520; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:15:47 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

dkNET community events and announcements in August, 2026

HIRN Funding Opportunity: SPARKS Award

Join the Whole Person Physiome 1st Data Jamboree on August 24-25

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch