Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pLKO.1-puro U6 sgRNA Oct4A -12 Resource Report Resource Website |
RRID:Addgene_50921 | Oct4A -12 sgRNA | Homo sapiens | Ampicillin | PMID:24346702 | gRNA target sequence GTGGGACTGGGGAGGGAGAG | Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:12 | 0 | |
|
pLKO.1-puro U6 sgRNA SOX17 -91 Resource Report Resource Website |
RRID:Addgene_50923 | Sox17 -91 sgRNA | Homo sapiens | Ampicillin | PMID:24346702 | gRNA target sequence GGGCGTGGGCCTAACGACGC | Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:10 | 0 | |
|
pLKO.1-puro U6 sgRNA Oct4A -158 Resource Report Resource Website |
RRID:Addgene_50922 | Oct4A -158 sgRNA | Homo sapiens | Ampicillin | PMID:24346702 | gRNA target sequence GGGGCGCCAGTTGTGTCTCC | Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:10 | 0 | |
|
pcDNA3.1 Flag YFP hNKCC1 I730C (NT504) Resource Report Resource Website |
RRID:Addgene_50884 | human NKCC1 (synthetic) | Homo sapiens | Ampicillin | PMID:24451383 | Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. | Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | I730C in hNKCC1 in NT17 | 2026-08-15 01:16:09 | 0 |
|
pRGE31 Resource Report Resource Website |
RRID:Addgene_50929 | Ampicillin | PMID:23956122 | Please use the reference links above to access a published protocol for using plasmids pRGE31, pRGEB31, pRGE32 and pRGEB32 as well as a CRISPR design software tool. | Backbone Marker:Nakagawa,T.; Backbone Size:6034; Vector Backbone:pUGW11; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:10 | 0 | |||
|
pLKO.1-puro U6 sgRNA SOX17 -177 Resource Report Resource Website |
RRID:Addgene_50925 | Sox17 -177 sgRNA | Homo sapiens | Ampicillin | PMID:24346702 | gRNA target sequence GCTCCGGCTAGTTTTCCCGG | Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:10 | 0 | |
|
pLKO.1-puro U6 sgRNA CAG Resource Report Resource Website 1+ mentions |
RRID:Addgene_50927 | negative control sgRNA | synthetic | Ampicillin | PMID:24346702 | Please note that Addgene's diagnostic digest results suggest that the backbone may be longer than suggested. | Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:13 | 4 | |
|
pLKO.1-puro U6 sgRNA SOX17 -296 Resource Report Resource Website |
RRID:Addgene_50926 | Sox17-296 sgRNA | Homo sapiens | Ampicillin | PMID:24346702 | gRNA target sequence GGGCAAGTACGTCGATTCCA | Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:10 | 0 | |
|
pcDNA3.1 Flag YFP hNKCC1 Y739C (NT525) Resource Report Resource Website |
RRID:Addgene_50893 | human NKCC1 (synthetic) | Homo sapiens | Ampicillin | Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. | Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Y739C in hNKCC1 in NT17 | 2026-08-15 01:16:09 | 0 | |
|
pcDNA3.1 Flag YFP hNKCC1 A720C C723S C724V (NT534) Resource Report Resource Website |
RRID:Addgene_50899 | human NKCC1 (synthetic) | Homo sapiens | Ampicillin | Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. | Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | A720C C723S C724V in hNKCC1 in NT17 | 2026-08-15 01:16:09 | 0 | |
|
p14-9VN9-3A Resource Report Resource Website |
RRID:Addgene_50932 | SRP14 and SRP9 | Homo sapiens | Ampicillin | Backbone Marker:Chang-Deng Hu (Addgene Plasmid# 22010); Backbone Size:5216; Vector Backbone:pBiFC-VN173; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Amino acids 60, 61 and 64 of SRP9 changed to alanine | 2026-08-15 01:16:10 | 0 | ||
|
pscAluYNF1 Resource Report Resource Website |
RRID:Addgene_50934 | scAluYNF1 | Homo sapiens | Ampicillin | PMID:25697503 | Backbone Marker:Dewannieux,M., Esnault,C. and Heidmann,T. (2003) LINE-mediated retrotransposition of marked Alu sequences. Nat. Genet., 35, 41-4; Backbone Size:2773; Vector Backbone:pAlu-NeoTet; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | the poly(A) linker and the right arm of the dimeric ALuYNF1 gene were removed | 2026-08-15 01:16:13 | 0 | |
|
pAluYNF1 Resource Report Resource Website |
RRID:Addgene_50933 | AluYNF1 | Homo sapiens | Ampicillin | PMID:25697503 | Backbone Marker:Dewannieux,M., Esnault,C. and Heidmann,T. (2003) LINE-mediated retrotransposition of marked Alu sequences. Nat. Genet., 35, 41-4; Backbone Size:2773; Vector Backbone:pAlu-NeoTet; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:10 | 0 | ||
|
pcDNA3.1 Flag YFP hNKCC1 V740C (NT526) Resource Report Resource Website |
RRID:Addgene_50894 | human NKCC1 (synthetic) | Homo sapiens | Ampicillin | Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. | Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | V740C in hNKCC1 in NT17 | 2026-08-15 01:16:12 | 0 | |
|
pcDNA3.1 Flag YFP hNKCC1 L718C C723S C724V (NT532) Resource Report Resource Website |
RRID:Addgene_50897 | human NKCC1 (synthetic) | Homo sapiens | Ampicillin | Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. | Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | L718C C723S C724V in hNKCC1 in NT17 | 2026-08-15 01:16:12 | 0 | |
|
pcDNA3.1 Flag YFP hNKCC1 L717C C723S C724V (NT531) Resource Report Resource Website |
RRID:Addgene_50896 | human NKCC1 (synthetic) | Homo sapiens | Ampicillin | Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. | Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | L717C C723S C724V in hNKCC1 in NT17 | 2026-08-15 01:16:09 | 0 | |
|
pET11a-hRanGAP1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_50941 | RanGTPase activating protein 1 | Homo sapiens | Ampicillin | PMID:22464730 | Backbone Marker:Novagen; Backbone Size:5677; Vector Backbone:pET11a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:10 | 1 | ||
|
pHR SFFVp PHAkt Cerulean Resource Report Resource Website 1+ mentions |
RRID:Addgene_50837 | PHAkt | Ampicillin | PMID:21909100 | Vector Backbone:pHR; Vector Types:Lentiviral, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:11 | 2 | |||
|
pHR SFFVp Phy-mCherry-CAAX Resource Report Resource Website 1+ mentions |
RRID:Addgene_50839 | PhyB 1-908 | Arabidopsis thaliana | Ampicillin | PMID:21909100 | Please note this plasmid is a crucial component of the system described in this additional reference: Toettcher JE, Weiner OD, Lim WA, Cell. 2013 Dec 5;155(6):1422-34. doi: 10.1016/j.cell.2013.11.004. (PMID 24315106) | Vector Backbone:pHR; Vector Types:Lentiviral, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:09 | 4 | |
|
pRBBm59 Resource Report Resource Website |
RRID:Addgene_48115 | promoter sacB - gfp | Ampicillin | PMID:17692983 | Backbone Marker:Malten et al., 2005; Vector Backbone:pMM1520; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:47 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.