Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

740,584 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pCBC-MT1T2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_50593 T1, gRNA scaffold, OsU3t plus, TaU3p, T2 Synthetic Chloramphenicol PMID:25432517 Please note that this plasmid runs as a dimer (>7kb) or multimer. Vector Backbone:pGWC; Vector Types:Plant Expression, CRISPR, PCR template; Bacterial Resistance:Chloramphenicol 2026-08-15 01:16:07 1
pCBC-MT3T4
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_50595 T3, gRNA scaffold, U6-26t plus, OsU3p, T4 Synthetic Chloramphenicol PMID:25432517 Vector Backbone:pGWC; Vector Types:Plant Expression, CRISPR, PCR template; Bacterial Resistance:Chloramphenicol 2026-08-15 01:16:07 1
pCBC-DT1T2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_50590 T1, U626t plus, U629p, T2 Synthetic Chloramphenicol PMID:25432517 Vector Backbone:pGWC; Vector Types:Plant Expression, CRISPR, PCR template; Bacterial Resistance:Chloramphenicol 2026-08-15 01:16:07 8
pCBC-DT3T4
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_50592 T3, gRNA scaffold, U6-1tplus, U6-26p, T4 Synthetic Chloramphenicol PMID:25432517 Vector Backbone:pGWC; Vector Types:Plant Expression, CRISPR, PCR template; Bacterial Resistance:Chloramphenicol 2026-08-15 01:16:07 3
pHIS3p:mEos2-Tub1+3'UTR::URA3
 
Resource Report
Resource Website 		RRID:Addgene_50640 mEos2-Tub1 Saccharomyces cerevisiae Ampicillin PMID:25711127 Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:07 0
pHIS3p:yomWasabi-Tub1+3'UTR::LEU2
 
Resource Report
Resource Website 		RRID:Addgene_50643 yomWasabi-Tub1 Saccharomyces cerevisiae Ampicillin PMID:25711127 Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:07 0
pBS-3xGFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_50659 3xGFP Synthetic Ampicillin PMID:12566428 Please note that this plasmid is unstable due to the tandem yeGFP genes. Screening of colonies is required prior to storage. See diagnostic digest for expected results. Vector Backbone:pBS; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:10 1
pLX-sgRNA
 
Resource Report
Resource Website
50+ mentions 		RRID:Addgene_50662 sgAAVS1 Ampicillin PMID:24336569 For more information on OE-PCR please see: http://en.wikipedia.org/wiki/Overlap_extension_polymerase_chain_reaction) gRNA target sequence GGGGCCACTAGGGACAGGAT Backbone Size:7000; Vector Backbone:pLX304; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:16:07 85
pCW-Cas9
 
Resource Report
Resource Website
100+ mentions 		RRID:Addgene_50661 humanized S. pyogenes Cas9 Ampicillin PMID:24336569 Depositors used delta-VPR and CMV VSV-G packaging plasmids Backbone Size:7600; Vector Backbone:pCW57.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:16:07 239
p1HD
 
Resource Report
Resource Website 		RRID:Addgene_50664 repeat 1HD Xanthamonas oryzae Ampicillin PMID:24287550 Vector Backbone:pBSK; Vector Types:TALEN; Bacterial Resistance:Ampicillin 2026-08-15 01:16:10 0
p1NI
 
Resource Report
Resource Website 		RRID:Addgene_50666 repeat 1NI Xanthamonas oryzae Ampicillin PMID:24287550 Vector Backbone:pBSK; Vector Types:TALEN; Bacterial Resistance:Ampicillin 2026-08-15 01:16:07 0
p1NG
 
Resource Report
Resource Website 		RRID:Addgene_50665 repeat 1NG Xanthamonas oryzae Ampicillin PMID:24287550 Vector Backbone:pBSK; Vector Types:TALEN; Bacterial Resistance:Ampicillin 2026-08-15 01:16:07 0
p2NI
 
Resource Report
Resource Website 		RRID:Addgene_50670 repeat 2NI Xanthamonas oryzae Ampicillin PMID:24287550 Vector Backbone:pBSK; Vector Types:TALEN; Bacterial Resistance:Ampicillin 2026-08-15 01:16:10 0
p4NI
 
Resource Report
Resource Website 		RRID:Addgene_50678 repeat 4NI Xanthamonas oryzae Ampicillin PMID:24287550 Vector Backbone:pBSK; Vector Types:TALEN; Bacterial Resistance:Ampicillin 2026-08-15 01:16:08 0
pIZ-Flag6His-BmAgo3
 
Resource Report
Resource Website 		RRID:Addgene_50559 BmAgo3 Bombyx mori Bleocin (Zeocin) PMID:19460866 Backbone Marker:Invitrogen; Backbone Size:2900; Vector Backbone:pIZ/V5-His; Vector Types:Insect Expression; Bacterial Resistance:Bleocin (Zeocin) 2026-08-15 01:16:07 0
p3NN
 
Resource Report
Resource Website 		RRID:Addgene_50675 repeat 3NN Xanthamonas oryzae Ampicillin PMID:24287550 Vector Backbone:pBSK; Vector Types:TALEN; Bacterial Resistance:Ampicillin 2026-08-15 01:16:08 0
p413GPD-hTPI Lys13Arg
 
Resource Report
Resource Website 		RRID:Addgene_50722 Triosephosphate isomerase 1 Homo sapiens Ampicillin PMID:24598263 Backbone Size:5805; Vector Backbone:p413GPD; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin changed Lysine 13 to Argenine 2026-08-15 01:16:08 0
pET20b- hTPI Ile170Val
 
Resource Report
Resource Website 		RRID:Addgene_50724 Triosephosphate isomerase 1 Homo sapiens Ampicillin PMID:24598263 Backbone Size:3591; Vector Backbone:pET20b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin changed Isoleucine 170 to Valine 2026-08-15 01:16:10 0
pFUS2_a4b
 
Resource Report
Resource Website 		RRID:Addgene_50686 LacZ + BsaI restriction sites Other Spectinomycin PMID:24287550 Backbone Marker:Invitrogen; Vector Backbone:pCR8; Vector Types:TALEN; Bacterial Resistance:Spectinomycin 2026-08-15 01:16:08 0
p413GPD-hTPI Ile170Val
 
Resource Report
Resource Website 		RRID:Addgene_50720 Triosephosphate isomerase 1 Homo sapiens Ampicillin PMID:24598263 Backbone Size:5805; Vector Backbone:p413GPD; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin Isoleucine 170 to Valine 2026-08-15 01:16:08 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

dkNET community events and announcements in August, 2026

HIRN Funding Opportunity: SPARKS Award

Join the Whole Person Physiome 1st Data Jamboree on August 24-25

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch