Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 270 showing 5381 ~ 5400 out of 740,584 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_50593

    This resource has 1+ mentions.

http://www.addgene.org/50593

Species: Synthetic
Genetic Insert: T1, gRNA scaffold, OsU3t plus, TaU3p, T2
Vector Backbone Description: Vector Backbone:pGWC; Vector Types:Plant Expression, CRISPR, PCR template; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:25432517
Comments: Please note that this plasmid runs as a dimer (>7kb) or multimer.

Proper citation: RRID:Addgene_50593 Copy   


  • RRID:Addgene_50595

    This resource has 1+ mentions.

http://www.addgene.org/50595

Species: Synthetic
Genetic Insert: T3, gRNA scaffold, U6-26t plus, OsU3p, T4
Vector Backbone Description: Vector Backbone:pGWC; Vector Types:Plant Expression, CRISPR, PCR template; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:25432517

Proper citation: RRID:Addgene_50595 Copy   


  • RRID:Addgene_50590

    This resource has 1+ mentions.

http://www.addgene.org/50590

Species: Synthetic
Genetic Insert: T1, U626t plus, U629p, T2
Vector Backbone Description: Vector Backbone:pGWC; Vector Types:Plant Expression, CRISPR, PCR template; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:25432517

Proper citation: RRID:Addgene_50590 Copy   


  • RRID:Addgene_50592

    This resource has 1+ mentions.

http://www.addgene.org/50592

Species: Synthetic
Genetic Insert: T3, gRNA scaffold, U6-1tplus, U6-26p, T4
Vector Backbone Description: Vector Backbone:pGWC; Vector Types:Plant Expression, CRISPR, PCR template; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:25432517

Proper citation: RRID:Addgene_50592 Copy   


http://www.addgene.org/50640

Species: Saccharomyces cerevisiae
Genetic Insert: mEos2-Tub1
Vector Backbone Description: Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25711127

Proper citation: RRID:Addgene_50640 Copy   


http://www.addgene.org/50643

Species: Saccharomyces cerevisiae
Genetic Insert: yomWasabi-Tub1
Vector Backbone Description: Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25711127

Proper citation: RRID:Addgene_50643 Copy   


  • RRID:Addgene_50659

    This resource has 1+ mentions.

http://www.addgene.org/50659

Species: Synthetic
Genetic Insert: 3xGFP
Vector Backbone Description: Vector Backbone:pBS; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12566428
Comments: Please note that this plasmid is unstable due to the tandem yeGFP genes. Screening of colonies is required prior to storage. See diagnostic digest for expected results.

Proper citation: RRID:Addgene_50659 Copy   


  • RRID:Addgene_50662

    This resource has 50+ mentions.

http://www.addgene.org/50662

Genetic Insert: sgAAVS1
Vector Backbone Description: Backbone Size:7000; Vector Backbone:pLX304; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24336569
Comments: For more information on OE-PCR please see: http://en.wikipedia.org/wiki/Overlap_extension_polymerase_chain_reaction) gRNA target sequence GGGGCCACTAGGGACAGGAT

Proper citation: RRID:Addgene_50662 Copy   


  • RRID:Addgene_50661

    This resource has 100+ mentions.

http://www.addgene.org/50661

Genetic Insert: humanized S. pyogenes Cas9
Vector Backbone Description: Backbone Size:7600; Vector Backbone:pCW57.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24336569
Comments: Depositors used delta-VPR and CMV VSV-G packaging plasmids

Proper citation: RRID:Addgene_50661 Copy   


  • RRID:Addgene_50664

http://www.addgene.org/50664

Species: Xanthamonas oryzae
Genetic Insert: repeat 1HD
Vector Backbone Description: Vector Backbone:pBSK; Vector Types:TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24287550

Proper citation: RRID:Addgene_50664 Copy   


  • RRID:Addgene_50666

http://www.addgene.org/50666

Species: Xanthamonas oryzae
Genetic Insert: repeat 1NI
Vector Backbone Description: Vector Backbone:pBSK; Vector Types:TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24287550

Proper citation: RRID:Addgene_50666 Copy   


  • RRID:Addgene_50665

http://www.addgene.org/50665

Species: Xanthamonas oryzae
Genetic Insert: repeat 1NG
Vector Backbone Description: Vector Backbone:pBSK; Vector Types:TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24287550

Proper citation: RRID:Addgene_50665 Copy   


  • RRID:Addgene_50670

http://www.addgene.org/50670

Species: Xanthamonas oryzae
Genetic Insert: repeat 2NI
Vector Backbone Description: Vector Backbone:pBSK; Vector Types:TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24287550

Proper citation: RRID:Addgene_50670 Copy   


  • RRID:Addgene_50678

http://www.addgene.org/50678

Species: Xanthamonas oryzae
Genetic Insert: repeat 4NI
Vector Backbone Description: Vector Backbone:pBSK; Vector Types:TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24287550

Proper citation: RRID:Addgene_50678 Copy   


  • RRID:Addgene_50559

http://www.addgene.org/50559

Species: Bombyx mori
Genetic Insert: BmAgo3
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2900; Vector Backbone:pIZ/V5-His; Vector Types:Insect Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:19460866

Proper citation: RRID:Addgene_50559 Copy   


  • RRID:Addgene_50675

http://www.addgene.org/50675

Species: Xanthamonas oryzae
Genetic Insert: repeat 3NN
Vector Backbone Description: Vector Backbone:pBSK; Vector Types:TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24287550

Proper citation: RRID:Addgene_50675 Copy   


http://www.addgene.org/50722

Species: Homo sapiens
Genetic Insert: Triosephosphate isomerase 1
Vector Backbone Description: Backbone Size:5805; Vector Backbone:p413GPD; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24598263

Proper citation: RRID:Addgene_50722 Copy   


http://www.addgene.org/50724

Species: Homo sapiens
Genetic Insert: Triosephosphate isomerase 1
Vector Backbone Description: Backbone Size:3591; Vector Backbone:pET20b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24598263

Proper citation: RRID:Addgene_50724 Copy   


  • RRID:Addgene_50686

http://www.addgene.org/50686

Species: Other
Genetic Insert: LacZ + BsaI restriction sites
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR8; Vector Types:TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:24287550

Proper citation: RRID:Addgene_50686 Copy   


http://www.addgene.org/50720

Species: Homo sapiens
Genetic Insert: Triosephosphate isomerase 1
Vector Backbone Description: Backbone Size:5805; Vector Backbone:p413GPD; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24598263

Proper citation: RRID:Addgene_50720 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X