Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pAAV-EF1a-DIO-mCherry Resource Report Resource Website 10+ mentions |
RRID:Addgene_50462 | mCherry | Aequorea victoria | Ampicillin | These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community. | Backbone Size:4818; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:08 | 34 | ||
|
pAAV-hSyn-HA-hM4D(Gi)-IRES-mCitrine Resource Report Resource Website 1+ mentions |
RRID:Addgene_50464 | hM4D(Gi)-IRES-mCitrine | Homo sapiens | Ampicillin | These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community. | Backbone Size:4818; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:06 | 9 | ||
|
pAAV-hSyn-HA-hM3D(Gq)-IRES-mCitrine Resource Report Resource Website 1+ mentions |
RRID:Addgene_50463 | hM3D(Gq)-IRES-mCitrine | Homo sapiens | Ampicillin | These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community. | Backbone Size:4818; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin | See supplemental documents for DREADD mutations | 2026-08-15 01:16:06 | 7 | |
|
pAAV-EF1a-DIO-hM3D(Gq)-mCherry Resource Report Resource Website 10+ mentions |
RRID:Addgene_50460 | hM3D(Gq)-mCherry | Homo sapiens | Ampicillin | These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community. | Backbone Size:4818; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin | See supplemental documents for DREADD mutations | 2026-08-15 01:16:06 | 29 | |
|
pAAV-CaMKIIa-EGFP Resource Report Resource Website 50+ mentions |
RRID:Addgene_50469 | EGFP | Aequorea victoria | Ampicillin | These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community. | Backbone Size:4818; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:06 | 74 | ||
|
pAAV-hSyn-EGFP Resource Report Resource Website 100+ mentions |
RRID:Addgene_50465 | EGFP | Aequorea victoria | Ampicillin | These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community. | Backbone Size:4818; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:08 | 223 | ||
|
pAAV-CaMKIIa-HA-rM3D(Gs)-IRES-mCitrine Resource Report Resource Website 1+ mentions |
RRID:Addgene_50468 | rM3D-IRES-mCitrine | Ampicillin | These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community. | Backbone Size:4818; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin | See supplemental documents for DREADD mutations | 2026-08-15 01:16:08 | 2 | ||
|
pAAV-GFAP-EGFP Resource Report Resource Website 10+ mentions |
RRID:Addgene_50473 | EGFP | Aequorea victoria | Ampicillin | These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community. | Backbone Size:4818; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:06 | 25 | ||
|
pAAV-GFAP-HA-rM3D(Gs)-IRES-mCitrine Resource Report Resource Website 1+ mentions |
RRID:Addgene_50472 | rM3D-IRES-mCitrine | Homo sapiens | Ampicillin | These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community. | Backbone Size:4818; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin | See supplemental documents for DREADD mutations | 2026-08-15 01:16:06 | 7 | |
|
pAAV-hSyn-hM4D(Gi)-mCherry Resource Report Resource Website 100+ mentions |
RRID:Addgene_50475 | hM4D(Gi)-mCherry | Ampicillin | Please Note- This plasmid does NOT contain an N-terminal HA tag. These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community. | Backbone Size:4818; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin | See supplemental documents for DREADD mutations | 2026-08-15 01:16:06 | 116 | ||
|
pAAV-GFAP-HA-hM3D(Gq)-IRES-mCitrine Resource Report Resource Website 1+ mentions |
RRID:Addgene_50470 | hM3D(Gq)-IRES-mCitrine | Homo sapiens | Ampicillin | These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community. | Backbone Size:4818; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin | See supplemental documents for DREADD mutations | 2026-08-15 01:16:06 | 1 | |
|
pAAV-GFAP-hM4D(Gi)-mCherry Resource Report Resource Website 10+ mentions |
RRID:Addgene_50479 | hM4D(Gi)-mCherry | Ampicillin | These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community. | Backbone Size:4818; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin | See supplemental documents for DREADD mutations | 2026-08-15 01:16:06 | 18 | ||
|
pIL2R FAK Resource Report Resource Website |
RRID:Addgene_50524 | protein tyrosine kinase, domain | Mus musculus | Ampicillin | PMID:1373145 | Vector contains truncated IL-2R alpha subunit without cytoplasmic domain (Tac antigen) for membrane localization and clustering | Backbone Marker:Bruce Howard Lab, PubMed ID 1373145; Vector Backbone:pCMVIL2R(pIL2R); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:08 | 0 | |
|
pTrcHisB-TRF2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_50488 | TRF2 | Homo sapiens | Ampicillin | PMID:25115914 | This set of TRF2 and TRF2 mutant vectors has been engineered reintroduce Alanine 434, which is deleted in most published TRF2 vectors, and to generate TRF2 and TRF2 mutant proteins with identical N-terminal tags. | Backbone Marker:Life Technologies; Backbone Size:4378; Vector Backbone:pTrcHisB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Contains amino acids 3-500 | 2026-08-15 01:16:06 | 2 |
|
FN 108 Resource Report Resource Website 1+ mentions |
RRID:Addgene_50495 | fibronectin | Homo sapiens | Ampicillin | PMID:7929152 | Primers used for amplification of insert: primer A (CCATATGGGTCGACCCAACTGG), which contains an NdeI site, methionine start codon, and 5' end of the 9th type III repeat sequence, and primer B (ATGAATTCTACATCTGGGATGGTTTGTCAA), which contains an EcoRI site, a stop codon, and the 3' end of the 37-kDa fibronectin fragment. | Vector Backbone:pVC70108; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | repeats 9 and 10; EcoR1 site on III-9 is mutated, nt change T4153C | 2026-08-15 01:16:06 | 1 |
|
FN207 Resource Report Resource Website |
RRID:Addgene_50497 | NM_001306129.1 | Homo sapiens | Ampicillin | PMID:7545166 | Backbone Marker:Invitrogen; Vector Backbone:pRSETC'; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | repeats 6-10 | 2026-08-15 01:16:06 | 0 | |
|
FN 127 Resource Report Resource Website |
RRID:Addgene_50496 | fibronectin | Homo sapiens | Ampicillin | Vector Backbone:pVC70108; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | repeats 9 and 10; P1407S, H1408P, R1410D; PHSRN to SPSDN, EcoR I site is mutated | 2026-08-15 01:16:08 | 0 | ||
|
FN 221 Resource Report Resource Website |
RRID:Addgene_50498 | fibronectin | Homo sapiens | Ampicillin | Backbone Marker:Invitrogen; Vector Backbone:pRSETC'; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | repeats 6-10, R1524K, D1526E, C1232A | 2026-08-15 01:16:06 | 0 | ||
|
pRKVSV-PTEN C124A Resource Report Resource Website |
RRID:Addgene_50539 | PTEN | Homo sapiens | Ampicillin | Backbone Marker:PMID 14729065; Vector Backbone:pRKVSV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | C124A | 2026-08-15 01:16:09 | 0 | ||
|
pBL6 Resource Report Resource Website 1+ mentions |
RRID:Addgene_50549 | mCherry | Synthetic | Ampicillin | PMID:24608181 | Note: Addgene's quality control sequencing found a few mismatches compared to the depositor's full sequence, but they should not affect plasmid function. | Backbone Marker:Registry of Standard Biological Parts; Backbone Size:3296; Vector Backbone:pSB4A3; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:06 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
