Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3800; Vector Backbone:pCMV-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Multiple cloning site (MCS) was changed from SfiI, EcoRI, SalI, BglII, XhoI, KpnI and NotI to match the MCS of the pCAGIG vector (Addgene plasmid #11159) EcoRI, XhoI, EcoRV and NotI. This changes the frame for fusion to the HA tag.
Top oligo: 5'- AGGAATTCCTCGAGGATATCGC -3' and Bottom oligo 5'- GGCCGCGATATCCTCGAGGAATTCCTCCA -3' were annealed and ligated into SfiI/NotI cut pCMV-HA. The SfiI site was destroyed in the process.
Proper citation: RRID:Addgene_32530 Copy
Species: Mus musculus
Genetic Insert: E1, ubiquitin-activating enzyme
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET-28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22012022
Proper citation: RRID:Addgene_32534 Copy
Species: Homo sapiens
Genetic Insert: Ataxin-1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:9620770
Proper citation: RRID:Addgene_32492 Copy
Species: Mus musculus
Genetic Insert: GPD1L 3'UTR
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21555452
Comments: Seed mutant sequence - GTCGACCTCAGTGAATGCGTGTC
Proper citation: RRID:Addgene_32490 Copy
Species: Homo sapiens
Genetic Insert: HSF1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12917326
Comments: Please note that mutation P448L in HSF1 was found during Addgene's quality control. This plasmid should function as reported in the associated publication.
Proper citation: RRID:Addgene_32537 Copy
Species: Homo sapiens
Genetic Insert: HSF1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4729; Vector Backbone:pEGFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12917326
Comments: Please note that mutation P448L in HSF1 was found during Addgene's quality control. This plasmid should function as reported in the associated publication.
Proper citation: RRID:Addgene_32538 Copy
Vector Backbone Description: Backbone Marker:Mo Bi Tec; Vector Backbone:PET01; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:18930792
Proper citation: RRID:Addgene_32485 Copy
Species: Mus musculus
Genetic Insert: GPD1L
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21555452
Proper citation: RRID:Addgene_32486 Copy
Species: Mus musculus
Genetic Insert: GPD1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21555452
Proper citation: RRID:Addgene_32487 Copy
Species: Rattus norvegicus
Genetic Insert: Constitutively active Rheb (S16H)
Vector Backbone Description: Backbone Marker:Addgene plasmid #32519; Vector Backbone:pHAGE-CMV-Rheb-IRES-eGFP-W; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20062052
Comments: The constitutively activating S16H mutation was introduced to pHAGE-CMV-Rheb-IRES-eGFP-W (Addgene plasmid #32519) by site directed mutagenesis.
The original pHAGE-CMV-IRES lentiviral vector is from Dr Richard C. Mulligan at Harvard (Mostoslavsky G et al., 2005).
Proper citation: RRID:Addgene_32520 Copy
Species: Homo sapiens
Genetic Insert: PSAML141F,Y115F-GlyR
Vector Backbone Description: Backbone Size:5100; Vector Backbone:AAV2; Vector Types:AAV, Cre/Lox, Adeno-associated virus, FLEX switch; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21885782
Comments: Comments:
These rAAV vectors are prone to recombination. This is a well known issue with these rAAV vectors and is due to the inverted terminal repeats (ITRs) required for rAAV production. To minimize recombination, we propagate these plasmids in NEB Stable cells. Also, to minimize recombination, cells should be cultured at 30 C.
Note that these cultures will grow slowly (20 h for minipreps). Better yields and culture times are obtained with 2xYT as the media. This is strongly recommended.
Because recombination may still happen, we do a panel of restriction digestions to assess whether the ITRs are in tact. Separate digestions with Sma1 and Msc1 should be performed. The expected patterns can be calculated from the attached sequence.
In Magnus et al, the PSAMY115F,L141F-GlyR channel was emphasized for silencing because this channel has the lowest acetylcholine responsiveness. However, PSAML141F-GlyR constructs, lacking the Y115F mutation, already have low ACh potency. The Y115F mutation also slightly increases the EC50 for the activator ligand, PSEM89S. Since PSAML141F-GlyR constructs already have very low acetylcholine potency, in many cases it may not be worth the slight reduction in PSEM potency. We have made both constructs available for researchers who may find that they have different requirements with respect to acetylcholine responsiveness.
Proper citation: RRID:Addgene_32481 Copy
Species: Homo sapiens
Genetic Insert: Protein tyrosine phosphatase receptor-type delta G1707R
Vector Backbone Description: Backbone Marker:System Biosciences ; Backbone Size:6606; Vector Backbone:pCDF1-MCS2-EF1-Puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19074898
Proper citation: RRID:Addgene_32526 Copy
Species: Homo sapiens
Genetic Insert: Protein tyrosine phosphatase receptor-type delta P1690F
Vector Backbone Description: Backbone Marker:System Biosciences ; Backbone Size:6606; Vector Backbone:pCDF1-MCS2-EF1-Puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19074898
Proper citation: RRID:Addgene_32525 Copy
Species: Homo sapiens
Genetic Insert: PSAMQ79G,Q139G-5HT3 HC
Vector Backbone Description: Backbone Size:7200; Vector Backbone:pCAGGS- IRES-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21885782
Proper citation: RRID:Addgene_32474 Copy
Species: Homo sapiens
Genetic Insert: PSAMQ79G,Q139G-5HT3HC
Vector Backbone Description: Backbone Size:5100; Vector Backbone:AAV2; Vector Types:AAV, Cre/Lox, Adeno-associated virus, FLEX switch; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21885782
Comments: These rAAV vectors are prone to recombination. This is a well known issue with these rAAV vectors and is due to the inverted terminal repeats (ITRs) required for rAAV production. To minimize recombination, we propagate these plasmids in NEB Stable cells. Also, to minimize recombination, cells should be cultured at 30 C.
Note that these cultures will grow slowly (20 h for minipreps). Better yields and culture times are obtained with 2xYT as the media. This is strongly recommended.
Because recombination may still happen, we do a panel of restriction digestions to assess whether the ITRs are in tact. Separate digestions with Sma1 and Msc1 should be performed. The expected patterns can be calculated from the attached sequence.
Proper citation: RRID:Addgene_32475 Copy
Species: Homo sapiens
Genetic Insert: PSAM Y115F,L141F-5HT3 HC
Vector Backbone Description: Backbone Size:7200; Vector Backbone:pCAGGS- IRES-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21885782
Proper citation: RRID:Addgene_32476 Copy
Vector Backbone Description: Backbone Size:12000; Vector Backbone:pCAMBIA1301; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20388670
Proper citation: RRID:Addgene_32470 Copy
Vector Backbone Description: Backbone Size:12000; Vector Backbone:pCAMBIA1301; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20388670
Proper citation: RRID:Addgene_32471 Copy
Species: Mus musculus
Genetic Insert: Pax7d
Vector Backbone Description: Backbone Marker:Addgene plasmid #32516; Backbone Size:7900; Vector Backbone:pOZ-FH-C-Puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19458195
Proper citation: RRID:Addgene_32518 Copy
Species: synthetic construct
Genetic Insert: GEX-GECO1.0
Vector Backbone Description: Backbone Size:4200; Vector Backbone:Customized Vector; Vector Types:Bacterial Expression, Lab constructed; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21903779
Comments: The vector is modified from pBAD/ His B (Invitrogen).
Proper citation: RRID:Addgene_32464 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
