Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 266 showing 5301 ~ 5320 out of 740,017 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_63294

http://www.addgene.org/63294

Species: Synthetic
Genetic Insert: NI NN NG
Vector Backbone Description: Backbone Size:3006; Vector Backbone:FusX2; Vector Types:TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:26854857

Proper citation: RRID:Addgene_63294 Copy   


  • RRID:Addgene_63296

http://www.addgene.org/63296

Species: Synthetic
Genetic Insert: NI NG HD
Vector Backbone Description: Backbone Size:3006; Vector Backbone:FusX2; Vector Types:TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:26854857

Proper citation: RRID:Addgene_63296 Copy   


  • RRID:Addgene_63229

http://www.addgene.org/63229

Species: Synthetic
Genetic Insert: NI NN NN
Vector Backbone Description: Backbone Size:3013; Vector Backbone:FusX1; Vector Types:TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:26854857

Proper citation: RRID:Addgene_63229 Copy   


  • RRID:Addgene_63225

http://www.addgene.org/63225

Species: Synthetic
Genetic Insert: NI HD NN
Vector Backbone Description: Backbone Size:3013; Vector Backbone:FusX1; Vector Types:TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:26854857

Proper citation: RRID:Addgene_63225 Copy   


  • RRID:Addgene_63228

http://www.addgene.org/63228

Species: Synthetic
Genetic Insert: NI NN HD
Vector Backbone Description: Backbone Size:3013; Vector Backbone:FusX1; Vector Types:TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:26854857

Proper citation: RRID:Addgene_63228 Copy   


  • RRID:Addgene_63221

http://www.addgene.org/63221

Species: Synthetic
Genetic Insert: NI NI NN
Vector Backbone Description: Backbone Size:3013; Vector Backbone:FusX1; Vector Types:TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:26854857

Proper citation: RRID:Addgene_63221 Copy   


  • RRID:Addgene_63222

http://www.addgene.org/63222

Species: Synthetic
Genetic Insert: NI NI NG
Vector Backbone Description: Backbone Size:3013; Vector Backbone:FusX1; Vector Types:TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:26854857

Proper citation: RRID:Addgene_63222 Copy   


  • RRID:Addgene_63224

http://www.addgene.org/63224

Species: Synthetic
Genetic Insert: NI HD HD
Vector Backbone Description: Backbone Size:3013; Vector Backbone:FusX1; Vector Types:TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:26854857

Proper citation: RRID:Addgene_63224 Copy   


http://www.addgene.org/55220

Vector Backbone Description: Vector Backbone:pFastBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28668116
Comments: In order to increase the efficiency of subcloning with the Series-11 Macrobac plasmids we developed a new strategy the uses LIC (Ligation Independent Cloning). The problem with the Series-11 ligation mediated subcloning was that when the plasmid size approached or exceeded 20 kb we had to screen many colonies to find a positive. We developed a strategy to use LIC for subcloning. Because this method uses no ligase, the cloning background associated with re-ligation of the empty plasmid are eliminated. 438-C has a TEV cleavable His6-MBP N10 at the N-terminus. MBP can improve expression and solubility of the target protein. The 438-C vector use the LICv1 Forward and Reverse primers. LICv1Forward - 5'-TACTTCCAATCCAATGCA-3' LICv1 Reverse - 5'-TTATCCACTTCCAATGTTATTA-3' As the target plasmid size gets >20kb you may have to increase the amount of DNA you anneal and/or transform. We have found this method gives no background colonies at all and 100% of the colonies we pick are positive. The cells we transform into are XL1Blues with a competency ~6x10^7cfu/ul. For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_55220 Copy   


  • RRID:Addgene_55228

http://www.addgene.org/55228

Species: Homo sapiens
Genetic Insert: Clathrin
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mAzurite; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 384; Emission = 450

Proper citation: RRID:Addgene_55228 Copy   


http://www.addgene.org/55195

Species: Homo sapiens
Genetic Insert: dCas9
Vector Backbone Description: Backbone Marker:Sally Temple; Backbone Size:8000; Vector Backbone:pFUGw (Addgene id: 25870); Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24837679
Comments: Please see http://www.rle.mit.edu/sbg/resources/ for more information.

Proper citation: RRID:Addgene_55195 Copy   


http://www.addgene.org/55194

Species: Homo sapiens
Genetic Insert: YFP(159-238)-gamma-12
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4800; Vector Backbone:pcDNAI/Amp; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16641313

Proper citation: RRID:Addgene_55194 Copy   


http://www.addgene.org/55192

Species: Homo sapiens
Genetic Insert: YFP-(159-238)-gamma-10
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4800; Vector Backbone:pcDNAI/Amp; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16641313

Proper citation: RRID:Addgene_55192 Copy   


  • RRID:Addgene_55190

http://www.addgene.org/55190

Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:4871; Vector Backbone:pPICZalpha C; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:23410102
Comments: C-terminal tags are separated by stop codons. Depending on the LP2 primer used in SLIC, the desired C-terminal tag(s) can be fused to the target gene. Use the one of the following linearization primers pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer: LP1 forward vector primer: SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3' LP2 - select an LP2 primer below depending on which C-terminal tags you want to include fused to your gene of interest: none SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3' 10His- SLIC Primer 5`GAGCATCATCATCATCACCAC 3' StrepOne - SLIC Primer 5`AGCGCTTGGAGCCACCCGCAG 3' S-Tag - SLIC Primer 5`AAAGAAACCGCTGCTGCTAAATTCG 3' HPC4 - SLIC Primer 5`GAGGACCAGGTGGACCCCCGG 3' Æ54CPD - SLIC Primer 5`GGCAGCGGCAAGATCCTGCAC 3' Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected.

Proper citation: RRID:Addgene_55190 Copy   


  • RRID:Addgene_55238

http://www.addgene.org/55238

Species: Other
Genetic Insert: CytERM
Vector Backbone Description: Backbone Size:4750; Vector Backbone:EBFP2-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: Cytochrome p450 . Excitation = 383; Emission = 448

Proper citation: RRID:Addgene_55238 Copy   


  • RRID:Addgene_55237

http://www.addgene.org/55237

Species: Homo sapiens
Genetic Insert: CENPB
Vector Backbone Description: Backbone Size:4750; Vector Backbone:EBFP2-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 383; Emission = 448

Proper citation: RRID:Addgene_55237 Copy   


  • RRID:Addgene_55236

    This resource has 1+ mentions.

http://www.addgene.org/55236

Species: Rattus norvegicus
Genetic Insert: CathespinB
Vector Backbone Description: Backbone Size:4750; Vector Backbone:EBFP2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:2445929
Comments: . Excitation = 383; Emission = 448

Proper citation: RRID:Addgene_55236 Copy   


http://www.addgene.org/55235

Species: Mus musculus
Genetic Insert: Beta-Catenin
Vector Backbone Description: Backbone Size:4750; Vector Backbone:EBFP2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 383; Emission = 448

Proper citation: RRID:Addgene_55235 Copy   


  • RRID:Addgene_55234

http://www.addgene.org/55234

Species: Homo sapiens
Genetic Insert: Vinculin
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mAzurite; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 384; Emission = 450

Proper citation: RRID:Addgene_55234 Copy   


http://www.addgene.org/55199

Species: Homo sapiens
Genetic Insert: ECFP
Vector Backbone Description: Backbone Size:3500; Vector Backbone:pGL2-Luc (Addgene #26280); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24837679
Comments: Please see http://www.rle.mit.edu/sbg/resources/ for more information.

Proper citation: RRID:Addgene_55199 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X