Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

744,118 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Authority

Sort Ascending

Sort Descending

 Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pAAV-hsyn_NES-His-rsCaMPARI-mRuby3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_120805 rsCaMPARI Synthetic Ampicillin PMID:32931424 Backbone Size:4270; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin Addgene 2026-10-24 02:04:24 1
K9L mutant of H3K9me3 biosensor
 
Resource Report
Resource Website 		RRID:Addgene_120807 Truncated YPet-HP1-EV linker-ECFP-mouse histone H3(K9L mutation) Mus musculus Ampicillin PMID:30478057 Backbone Size:4717; Vector Backbone:pCAGGS vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin lysine 9 is mutated to leucine 9 on histone H3 Addgene 2026-10-24 02:04:24 0
NM R2E2 GFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_1208 sup35 NM domain Saccharomyces cerevisiae Ampicillin PMID:10448860 Backbone Size:4847; Vector Backbone:pRS316; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2 additional copies of second oligopeptide repeat in sup35 N domain Addgene 2026-10-24 02:04:24 1
H3S10ph biosensor
 
Resource Report
Resource Website 		RRID:Addgene_120809 Mouse histone H3-CFP-FHA2-histone H3 peptide (1-14aa)-YFP Mus musculus Ampicillin PMID:30478057 Backbone Marker:Invitrogen; Backbone Size:5368; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Threonine 3, Threonine 6, and Threonine 11 are mutated to Alanine on histone H3 peptide (1-14aa) Addgene 2026-10-24 02:04:24 0
pACYC-Cas12g1-noncoding
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_120880 Noncoding sequences for CRISPR-Cas12g1 Synthetic Chloramphenicol PMID:30523077 For more information, please visit us at https://arbor.bio/. For commercial use or questions, please contact us at [email protected]. Backbone Marker:ATCC; Backbone Size:4327; Vector Backbone:pACYC184; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Chloramphenicol Addgene 2026-10-24 02:04:25 1
pET28a-mH6-Cas12i1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_120882 Cas12i1 Synthetic Kanamycin PMID:30523077 For more information, please visit us at https://arbor.bio/. For commercial use or questions, please contact us at [email protected]. mH6 sequence: ATGAAAATCGAAGAAGGTAAAGGTCACCATCACCATCACCAC Backbone Marker:Novagen; Backbone Size:5349; Vector Backbone:pET-28a+; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Kanamycin WT Addgene 2026-10-24 02:04:25 3
GalT-moxMaple3
 
Resource Report
Resource Website 		RRID:Addgene_120884 moxMaple3 Synthetic Kanamycin PMID:30283009 Vector Backbone:pEGFP based; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Addgene 2026-10-24 02:04:25 0
ER-moxMaple3
 
Resource Report
Resource Website 		RRID:Addgene_120885 moxMaple3 Synthetic Kanamycin PMID:30283009 Please Note: Plasmid contains a 72 basepair deletion in the SV40 promoter sequence upstream of NeoR/KanR compared to the ER-mRFP vector backbone. This deletion is not known to affect plasmid function. Backbone Marker:Addgene plasmid 62236; Vector Backbone:ER-mRFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Addgene 2026-10-24 02:04:25 0
pVLAD6-mmPtch1-B-SBP
 
Resource Report
Resource Website 		RRID:Addgene_120886 ptch1 Mus musculus Ampicillin PMID:30415841 Vector Backbone:pVLAD6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin deleted amino acids 620-643, truncated at 1291 Addgene 2026-10-24 02:04:25 0
PB-fLuc=tdT
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_120870 pcDNA3-fLuc=tdT Synthetic Ampicillin PMID:34650390 Backbone Size:5297; Vector Backbone:PB-CAG-eGFPd2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-10-24 02:04:25 1
pBAD/HisD-moxMaple3
 
Resource Report
Resource Website 		RRID:Addgene_120871 moxMaple3 Synthetic Ampicillin PMID:30283009 Vector Backbone:pBAD/His-D; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin from mMaple3, moxMaple3 was engineered by replacing Cysteines 110 and 180 with Alanines or Valines, and the consensus N-linked Asparagines with Glutamine and Aspartic acid Addgene 2026-10-24 02:04:25 0
pET28a-mH6-Cas12c2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_120873 Cas12c2 Synthetic Kanamycin PMID:30523077 For more information, please visit us at https://arbor.bio/. For commercial use or questions, please contact us at [email protected]. mH6 sequence: ATGAAAATCGAAGAAGGTAAAGGTCACCATCACCATCACCAC Backbone Marker:Novagen; Backbone Size:5355; Vector Backbone:pET-28a+; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Kanamycin Addgene 2026-10-24 02:04:25 3
pMT-P3
 
Resource Report
Resource Website 		RRID:Addgene_120865 Permuteposon P3 Synthetic Kanamycin PMID:31128779 For detailed annotations of the modified R1R2 and R2R1 sites see the Genbank file under Resource Information/Supplemental Documents. Vector Backbone:ColE1; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin Addgene 2026-10-24 02:04:25 0
pMT-P4
 
Resource Report
Resource Website 		RRID:Addgene_120866 Permuteposon P4 Synthetic Kanamycin PMID:31128779 For detailed annotations of the modified R1R2 and R2R1 sites see the Genbank file under Resource Information/Supplemental Documents. Vector Backbone:ColE1; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin Addgene 2026-10-24 02:04:25 0
PB-Aka-P2A-GFP
 
Resource Report
Resource Website 		RRID:Addgene_120867 Akaluc Synthetic Ampicillin PMID:34650390 Backbone Marker:pCAGGFP; Backbone Size:6310; Vector Backbone:PB-CAG-eGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin insert Akaluc and a P2A site Addgene 2026-10-24 02:04:25 0
PB-Antares2
 
Resource Report
Resource Website 		RRID:Addgene_120868 pcDNA3-Antares2 Synthetic Ampicillin PMID:34650390 Backbone Marker:SynBio-Tech; Backbone Size:5290; Vector Backbone:PB-CAG-eGFPd2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Antares2 amplicon Addgene 2026-10-24 02:04:25 0
Antares2-N1
 
Resource Report
Resource Website 		RRID:Addgene_120869 Akaluc Synthetic Kanamycin PMID:34650390 Backbone Marker:ClonTech; Backbone Size:4023; Vector Backbone:N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Addgene 2026-10-24 02:04:25 0
FLAG-PPP2R5E siRNA-resistant
 
Resource Report
Resource Website 		RRID:Addgene_120861 PPP2R5E Homo sapiens Ampicillin PMID:28404789 Backbone Marker:ThermoFIsher; Backbone Size:2300; Vector Backbone:pcDNA5/FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin silent mutation at aa 282-284 in PPP2RE to generate siRNA-resistant RNA Addgene 2026-10-24 02:04:25 0
NK695
 
Resource Report
Resource Website 		RRID:Addgene_120854 pac-P2A-Jumblelw1-mTFP Ampicillin Vector Backbone:NK676; Vector Types:Choanoflagellate expression; Bacterial Resistance:Ampicillin Jumblelw1 allele: T to C at nt 1109 causes L305P mutation Addgene 2026-10-24 02:04:25 0
NK696
 
Resource Report
Resource Website 		RRID:Addgene_120855 pac-P2A-mTFP-Jumble Ampicillin Vector Backbone:NK676; Vector Types:Choanoflagellate expression; Bacterial Resistance:Ampicillin Addgene 2026-10-24 02:04:25 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

Join the NIDDK-CR Webinar "Pixels to Phenotypes – Whole Slide Imaging Pathomics” on October 28, 2026

dkNET Webinar: Gene Regulatory Network Analysis in Texera

dkNET Webinar: A Hormone Cell Atlas Maps the Human Endocrine System at Cellular Resolution

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch