Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 26 showing 501 ~ 520 out of 1,737 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_208317

http://www.addgene.org/208317

Species: E. coli
Genetic Insert: TadA-RA5.6-SpCas9 D10A
Vector Backbone Description: Backbone Size:3402; Vector Backbone:pCMV with a BR322 origin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38168987

Proper citation: RRID:Addgene_208317 Copy   


  • RRID:Addgene_208310

http://www.addgene.org/208310

Species: E. coli
Genetic Insert: TadA-RA4.5-SpCas9 D10A
Vector Backbone Description: Backbone Size:3402; Vector Backbone:pCMV with a BR322 origin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38168987

Proper citation: RRID:Addgene_208310 Copy   


  • RRID:Addgene_208311

http://www.addgene.org/208311

Species: E. coli
Genetic Insert: TadA-RA4.6-SpCas9 D10A
Vector Backbone Description: Backbone Size:3402; Vector Backbone:pCMV with a BR322 origin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38168987

Proper citation: RRID:Addgene_208311 Copy   


  • RRID:Addgene_208295

http://www.addgene.org/208295

Species: E. coli
Genetic Insert: TadA8r-V106W-SpCas9 D10A
Vector Backbone Description: Backbone Size:3402; Vector Backbone:pCMV with a BR322 origin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38168987

Proper citation: RRID:Addgene_208295 Copy   


  • RRID:Addgene_208297

http://www.addgene.org/208297

Species: E. coli
Genetic Insert: TadA-RA1.0-SpCas9 D10A
Vector Backbone Description: Backbone Size:3402; Vector Backbone:pCMV with a BR322 origin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38168987

Proper citation: RRID:Addgene_208297 Copy   


  • RRID:Addgene_208298

http://www.addgene.org/208298

Species: E. coli
Genetic Insert: TadA-RA1.1-SpCas9 D10A
Vector Backbone Description: Backbone Size:3402; Vector Backbone:pCMV with a BR322 origin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38168987

Proper citation: RRID:Addgene_208298 Copy   


  • RRID:Addgene_208294

http://www.addgene.org/208294

Species: E. coli
Genetic Insert: TadA8r-SpCas9 D10A
Vector Backbone Description: Backbone Size:3402; Vector Backbone:pCMV with a BR322 origin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38168987

Proper citation: RRID:Addgene_208294 Copy   


  • RRID:Addgene_207600

http://www.addgene.org/207600

Species: E. coli
Genetic Insert: GFP-ABB
Vector Backbone Description: Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37972066

Proper citation: RRID:Addgene_207600 Copy   


  • RRID:Addgene_207586

http://www.addgene.org/207586

Species: E. coli
Genetic Insert: GFP-TolA H22A
Vector Backbone Description: Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37972066

Proper citation: RRID:Addgene_207586 Copy   


  • RRID:Addgene_207592

http://www.addgene.org/207592

Species: E. coli
Genetic Insert: GFP-TonB deltaII
Vector Backbone Description: Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37972066

Proper citation: RRID:Addgene_207592 Copy   


  • RRID:Addgene_207594

http://www.addgene.org/207594

Species: E. coli
Genetic Insert: GFP-TonB deltaPII
Vector Backbone Description: Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37972066

Proper citation: RRID:Addgene_207594 Copy   


  • RRID:Addgene_207590

http://www.addgene.org/207590

Species: E. coli
Genetic Insert: GFP-ABBA
Vector Backbone Description: Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37972066

Proper citation: RRID:Addgene_207590 Copy   


  • RRID:Addgene_207595

http://www.addgene.org/207595

Species: E. coli
Genetic Insert: GFP-BAB
Vector Backbone Description: Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37972066

Proper citation: RRID:Addgene_207595 Copy   


  • RRID:Addgene_207596

http://www.addgene.org/207596

Species: E. coli
Genetic Insert: GFP-AAB
Vector Backbone Description: Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37972066

Proper citation: RRID:Addgene_207596 Copy   


  • RRID:Addgene_207597

http://www.addgene.org/207597

Species: E. coli
Genetic Insert: GFP-AABB
Vector Backbone Description: Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37972066

Proper citation: RRID:Addgene_207597 Copy   


  • RRID:Addgene_207603

http://www.addgene.org/207603

Species: E. coli
Genetic Insert: GFP-AIA
Vector Backbone Description: Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37972066

Proper citation: RRID:Addgene_207603 Copy   


  • RRID:Addgene_207604

http://www.addgene.org/207604

Species: E. coli
Genetic Insert: GFP-BIB
Vector Backbone Description: Vector Backbone:pBAD24; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37972066
Comments: Gene was synthesised with codon optimisation

Proper citation: RRID:Addgene_207604 Copy   


http://www.addgene.org/210863

Species: E. coli
Genetic Insert: acrA
Vector Backbone Description: Vector Backbone:pBbA5k; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38270583

Proper citation: RRID:Addgene_210863 Copy   


  • RRID:Addgene_182960

http://www.addgene.org/182960

Species: E. coli
Genetic Insert: gRNA (acctggtgaagccaatattc), homologous repair template for ptsI
Vector Backbone Description: Vector Backbone:CoEi*; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38252823

Proper citation: RRID:Addgene_182960 Copy   


  • RRID:Addgene_182963

http://www.addgene.org/182963

Species: E. coli
Genetic Insert: ptsI
Vector Backbone Description: Vector Backbone:pACYC177; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38252823

Proper citation: RRID:Addgene_182963 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X