Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Marker:PMID: 17878951; Backbone Size:4650; Vector Backbone:pDEST-pSP172BSSPE-Swa1::RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:17878951
Comments: Gateway destination vector for electroporation experiments. Backbone was modified by insertion of tag at SwaI restriction site
Proper citation: RRID:Addgene_186397 Copy
Vector Backbone Description: Backbone Marker:PMID: 9043074; Backbone Size:4650; Vector Backbone:Ascidian electroporation vector pSP72-1.27; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:17878951
Comments: Gateway destination vector for electroporation experiments. The electroporation vector pSP72-1.27 was modified to give rise to pSP72BSSPE by replacing the NLS-LacZ reporter gene, cloned between BamH1 and EcoR1 by a BamH1-Swa1-Stu1-Pme1-EcoRV-EcoR1 polylinker (GGATCCATTTAAATAGGCCTTTGTTTAAACTTAGATATCGGAATTC).
Proper citation: RRID:Addgene_186396 Copy
Vector Backbone Description: Backbone Size:5412; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of C terminal Snap-tag tag at EcoR V/Avr II restriction site
Proper citation: RRID:Addgene_186395 Copy
Vector Backbone Description: Backbone Marker:PMID: 17878951; Backbone Size:5370; Vector Backbone:pDEST-pSP172BSSPE-Swa1::RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:17878951
Comments: Gateway destination vector for electroporation experiments. Backbone was modified by insertion of C terminal ECFP tag at EcoR V restriction site
Proper citation: RRID:Addgene_186402 Copy
Vector Backbone Description: Backbone Marker:PMID: 17878951; Backbone Size:5385; Vector Backbone:pDEST-pSP172BSSPE-Swa1::venus-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:17878951
Comments: Gateway destination vector for electroporation experiments. Backbone was modified by insertion of N terminal Venus tag at SwaI restriction site
Proper citation: RRID:Addgene_186400 Copy
Vector Backbone Description: Backbone Marker:PMID: 17878951; Vector Backbone:pDEST-pSP172BSSPE-Swa1::RfA-ECFP; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:17878951
Comments: Gateway destination vector for electroporation experiments. Erroneously annotated in the article PMID 17878951 as pSP72BSSPE-pFOG::RfA-CFP
Proper citation: RRID:Addgene_186403 Copy
Vector Backbone Description: Backbone Size:5589; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of N terminal mCherry tag at Bgl II/Stu I restriction site
Proper citation: RRID:Addgene_186378 Copy
Vector Backbone Description: Backbone Marker:PMID: 17878951; Backbone Size:4888; Vector Backbone:pDEST-Spe3-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. This plasmid was obtained by gene synthesis from pDEST-Spe3-RfA by addition of a BglII-ZraI-AatII-StuI-SnaBI (agatctgacgtcaggccttacgta) polylinker before the attR1 sequence and an EcoRV-SacII-AfeI-BstEII-AvrII (gatatcgcggccgcggaagcgctggttacctagg) polylinker after the attR2 sequence.
Proper citation: RRID:Addgene_186375 Copy
Vector Backbone Description: Backbone Marker:PMID: 17878951; Backbone Size:4915; Vector Backbone:pDEST-Spe3-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:17878951
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of C terminal HA tag at EcoR V restriction site
Proper citation: RRID:Addgene_186374 Copy
Vector Backbone Description: Backbone Marker:PMID: 17878951; Backbone Size:4926; Vector Backbone:pDEST-Spe3-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:17878951
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of N terminal HA tag at Stu I restriction site
Proper citation: RRID:Addgene_186373 Copy
Vector Backbone Description: Backbone Marker:David Root (Addgene plasmid # 41393); Vector Backbone:pCW57.1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Proper citation: RRID:Addgene_194075 Copy
Genetic Insert: Hygromycin resistance
Vector Backbone Description: Backbone Marker:Erik Jorgensen Lab; Backbone Size:7539; Vector Backbone:pCFJ210; Vector Types:Worm Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:34323215
Proper citation: RRID:Addgene_193330 Copy
Vector Backbone Description: Backbone Marker:Root Lab, Addgene; Backbone Size:9396; Vector Backbone:pLIX_403 (Addgene 41395); Vector Types:Mammalian Expression, Lentiviral, Gateway Destination vector, Doxycycline inducible; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:33963355
Proper citation: RRID:Addgene_183901 Copy
Vector Backbone Description: Backbone Size:9670; Vector Backbone:plex_306; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Proper citation: RRID:Addgene_201132 Copy
Vector Backbone Description: Backbone Size:9514; Vector Backbone:plex_306; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Proper citation: RRID:Addgene_201133 Copy
Vector Backbone Description: Backbone Size:10414; Vector Backbone:plex_307; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Proper citation: RRID:Addgene_201140 Copy
Vector Backbone Description: Backbone Size:5811; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of N terminal emiRFP703 tag at Bgl II/Stu I restriction site
Proper citation: RRID:Addgene_186376 Copy
Vector Backbone Description: Vector Backbone:394-pDestTol2pA2; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:37601640
Proper citation: RRID:Addgene_171796 Copy
Vector Backbone Description: Backbone Size:7072; Vector Backbone:R4-R2 Gateway Destination clone for Tol2kit reaction (GFP under Crystallin promoter marker); Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:37601640
Proper citation: RRID:Addgene_171795 Copy
Vector Backbone Description: Backbone Size:5376; Vector Backbone:Destination clone; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:37601640
Proper citation: RRID:Addgene_171794 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.