Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Bmp2 promoter (shorter sequence)
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3 basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9003457
Proper citation: RRID:Addgene_49347 Copy
Species: Mus musculus
Genetic Insert: Bmp2 distal promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5598; Vector Backbone:pGL2 basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15358784
Comments: 5' region contains nt –1,237 to 471 relative to distal transcription start.
3' region contains nt 9574-11604 relative to distal transcription start and contains two Bmp2 polyadenylation signals yielding 3’UTRs of 870 and 1185 nt (Liu et al. PMID 18703506) and downstream flanking sequence.
Proper citation: RRID:Addgene_49346 Copy
Species: Mus musculus
Genetic Insert: Bmp2 distal promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5598; Vector Backbone:pGL2 basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14757762
Proper citation: RRID:Addgene_49344 Copy
Genetic Insert: eGFP
Vector Backbone Description: Backbone Marker:Richard Mulligan; Backbone Size:4874; Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23403494
Proper citation: RRID:Addgene_49343 Copy
Vector Backbone Description: Backbone Marker:Stratagene; Vector Backbone:pBluescript; Vector Types:cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24116091
Proper citation: RRID:Addgene_49297 Copy
Vector Backbone Description: Backbone Marker:Stratagene; Vector Backbone:pBluescript; Vector Types:cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24116091
Proper citation: RRID:Addgene_49295 Copy
Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:Dr. James Sutherland ; Backbone Size:6600; Vector Backbone:pAc-STABLE1-Puro; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24326186
Comments: gRNA target sequence GGTTTTGGACACTGGAACCG
Proper citation: RRID:Addgene_49331 Copy
Species: Synthetic
Genetic Insert: GBP7-p65 transactivation domain fusion protein
Vector Backbone Description: Backbone Size:4823; Vector Backbone:pCAG-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23953120
Comments: Kirchhofer, A. et al. (2010). Modulation of protein properties in living cells using nanobodies. Nat. Struct. Mol. Biol. 17, 133–138.
Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39.
Proper citation: RRID:Addgene_49441 Copy
Species: Homo sapiens
Genetic Insert: Rab6AQ72LdeltaCSC
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:7300; Vector Backbone:GBK-T7; Vector Types:Yeast Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17908815
Proper citation: RRID:Addgene_49558 Copy
Species: Synthetic
Genetic Insert: GPD-roGFP2
Vector Backbone Description: Backbone Marker:ViraQuest Inc.; Backbone Size:5217; Vector Backbone:VQ Ad5CMV K-NpA; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20019331
Proper citation: RRID:Addgene_49436 Copy
Species: Synthetic
Genetic Insert: roGFP2
Vector Backbone Description: Backbone Marker:ViraQuest Inc.; Backbone Size:5217; Vector Backbone:VQ Ad5CMV K-NpA; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20019331
Proper citation: RRID:Addgene_49435 Copy
Species: Homo sapiens
Genetic Insert: Rab1AQ70L
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:7300; Vector Backbone:GBK-T7; Vector Types:Yeast Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17908815
Proper citation: RRID:Addgene_49555 Copy
Species: Synthetic
Genetic Insert: GBP2-Gal4 DNA binding domain fusion protein
Vector Backbone Description: Backbone Size:4823; Vector Backbone:pCAG-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23953120
Comments: Kirchhofer, A. et al. (2010). Modulation of protein properties in living cells using nanobodies. Nat. Struct. Mol. Biol. 17, 133–138.
Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39.
Proper citation: RRID:Addgene_49439 Copy
Species: Synthetic
Genetic Insert: GBP1-Gal4 DNA binding domain fusion protein
Vector Backbone Description: Backbone Size:4823; Vector Backbone:pCAG-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23953120
Comments: The GBP1 used differs from the PDB GBP1 by two amino acids. One is Q3D at a site away from the GFP binding pocket and not expected to affect GFP binding. The second was a C98S mutation to enhance protein solubility.
Kirchhofer, A. et al. (2010). Modulation of protein properties in living cells using nanobodies. Nat. Struct. Mol. Biol. 17, 133–138.
Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39.
Proper citation: RRID:Addgene_49438 Copy
Species: Homo sapiens
Genetic Insert: Rab6BAQ72LdeltaCSC
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:7300; Vector Backbone:GBK-T7; Vector Types:Yeast Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17908815
Proper citation: RRID:Addgene_49559 Copy
Species: Homo sapiens
Genetic Insert: Rab11A
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:EGFP C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17908815
Proper citation: RRID:Addgene_49553 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: autophagy-related 8
Vector Backbone Description: Backbone Size:4898; Vector Backbone:pRS416; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11739783
Proper citation: RRID:Addgene_49425 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: autophagy-related 8
Vector Backbone Description: Backbone Size:4788; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12589048
Proper citation: RRID:Addgene_49424 Copy
Species: Homo sapiens
Genetic Insert: Rab10T23N
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:EGFP C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20345488
Proper citation: RRID:Addgene_49545 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: autophagy-related 8
Vector Backbone Description: Backbone Size:4898; Vector Backbone:pRS416; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22977244
Proper citation: RRID:Addgene_49423 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
