Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 253 showing 5041 ~ 5060 out of 740,326 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_49363

http://www.addgene.org/49363

Species: Vibrio fischeri
Genetic Insert: LitR repressor
Vector Backbone Description: Vector Backbone:pEXT20; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24316737
Comments: Plasmid also contains YFP reporter (whose expression is controlled by a constitutive promoter containing an operator site for the indicated repressor).

Proper citation: RRID:Addgene_49363 Copy   


  • RRID:Addgene_49357

http://www.addgene.org/49357

Species: Escherichia coli
Genetic Insert: BetI repressor
Vector Backbone Description: Vector Backbone:pEXT20; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24316737
Comments: Plasmid also contains YFP reporter (whose expression is controlled by a constitutive promoter containing an operator site for the indicated repressor).

Proper citation: RRID:Addgene_49357 Copy   


  • RRID:Addgene_49352

    This resource has 1+ mentions.

http://www.addgene.org/49352

Species: Synthetic
Genetic Insert: luc2
Vector Backbone Description: Backbone Marker:Genscript; Backbone Size:2693; Vector Backbone:pUC57; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25177895

Proper citation: RRID:Addgene_49352 Copy   


  • RRID:Addgene_49356

http://www.addgene.org/49356

Species: Agrobacterium tumefaciens
Genetic Insert: AmeR repressor
Vector Backbone Description: Vector Backbone:pEXT20; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24316737
Comments: Plasmid also contains YFP reporter (whose expression is controlled by a constitutive promoter containing an operator site for the indicated repressor).

Proper citation: RRID:Addgene_49356 Copy   


  • RRID:Addgene_49349

    This resource has 10+ mentions.

http://www.addgene.org/49349

Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4238; Vector Backbone:pGL4; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:25177895

Proper citation: RRID:Addgene_49349 Copy   


  • RRID:Addgene_49343

    This resource has 10+ mentions.

http://www.addgene.org/49343

Genetic Insert: eGFP
Vector Backbone Description: Backbone Marker:Richard Mulligan; Backbone Size:4874; Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23403494

Proper citation: RRID:Addgene_49343 Copy   


  • RRID:Addgene_49297

http://www.addgene.org/49297

Vector Backbone Description: Backbone Marker:Stratagene; Vector Backbone:pBluescript; Vector Types:cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24116091

Proper citation: RRID:Addgene_49297 Copy   


  • RRID:Addgene_49295

http://www.addgene.org/49295

Vector Backbone Description: Backbone Marker:Stratagene; Vector Backbone:pBluescript; Vector Types:cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24116091

Proper citation: RRID:Addgene_49295 Copy   


  • RRID:Addgene_49331

    This resource has 1+ mentions.

http://www.addgene.org/49331

Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:Dr. James Sutherland ; Backbone Size:6600; Vector Backbone:pAc-STABLE1-Puro; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24326186
Comments: gRNA target sequence GGTTTTGGACACTGGAACCG

Proper citation: RRID:Addgene_49331 Copy   


http://www.addgene.org/49558

Species: Homo sapiens
Genetic Insert: Rab6AQ72LdeltaCSC
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:7300; Vector Backbone:GBK-T7; Vector Types:Yeast Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17908815

Proper citation: RRID:Addgene_49558 Copy   


  • RRID:Addgene_49436

    This resource has 1+ mentions.

http://www.addgene.org/49436

Species: Synthetic
Genetic Insert: GPD-roGFP2
Vector Backbone Description: Backbone Marker:ViraQuest Inc.; Backbone Size:5217; Vector Backbone:VQ Ad5CMV K-NpA; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20019331

Proper citation: RRID:Addgene_49436 Copy   


  • RRID:Addgene_49435

    This resource has 10+ mentions.

http://www.addgene.org/49435

Species: Synthetic
Genetic Insert: roGFP2
Vector Backbone Description: Backbone Marker:ViraQuest Inc.; Backbone Size:5217; Vector Backbone:VQ Ad5CMV K-NpA; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20019331

Proper citation: RRID:Addgene_49435 Copy   


  • RRID:Addgene_49555

http://www.addgene.org/49555

Species: Homo sapiens
Genetic Insert: Rab1AQ70L
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:7300; Vector Backbone:GBK-T7; Vector Types:Yeast Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17908815

Proper citation: RRID:Addgene_49555 Copy   


http://www.addgene.org/49559

Species: Homo sapiens
Genetic Insert: Rab6BAQ72LdeltaCSC
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:7300; Vector Backbone:GBK-T7; Vector Types:Yeast Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17908815

Proper citation: RRID:Addgene_49559 Copy   


  • RRID:Addgene_49553

    This resource has 1+ mentions.

http://www.addgene.org/49553

Species: Homo sapiens
Genetic Insert: Rab11A
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:EGFP C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17908815

Proper citation: RRID:Addgene_49553 Copy   


  • RRID:Addgene_49425

    This resource has 1+ mentions.

http://www.addgene.org/49425

Species: Saccharomyces cerevisiae
Genetic Insert: autophagy-related 8
Vector Backbone Description: Backbone Size:4898; Vector Backbone:pRS416; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11739783

Proper citation: RRID:Addgene_49425 Copy   


  • RRID:Addgene_49424

    This resource has 1+ mentions.

http://www.addgene.org/49424

Species: Saccharomyces cerevisiae
Genetic Insert: autophagy-related 8
Vector Backbone Description: Backbone Size:4788; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12589048

Proper citation: RRID:Addgene_49424 Copy   


  • RRID:Addgene_49545

    This resource has 1+ mentions.

http://www.addgene.org/49545

Species: Homo sapiens
Genetic Insert: Rab10T23N
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:EGFP C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20345488

Proper citation: RRID:Addgene_49545 Copy   


  • RRID:Addgene_49423

    This resource has 1+ mentions.

http://www.addgene.org/49423

Species: Saccharomyces cerevisiae
Genetic Insert: autophagy-related 8
Vector Backbone Description: Backbone Size:4898; Vector Backbone:pRS416; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22977244

Proper citation: RRID:Addgene_49423 Copy   


  • RRID:Addgene_49428

    This resource has 1+ mentions.

http://www.addgene.org/49428

Species: Homo sapiens
Genetic Insert: AF-9
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5100; Vector Backbone:pcDNA5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21729782

Proper citation: RRID:Addgene_49428 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X