Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:rattus norvegicus (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

2,175 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
GFP-C1-CAMKIIalpha
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_21226 CAMKIIalpha Rattus norvegicus Kanamycin PMID:9768845 Backbone Marker:Clontech; Backbone Size:4725; Vector Backbone:C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Lab plasmid KS 0001. 2026-08-15 01:12:01 10
pEGFP-C1-CaMKIIbeta(A303R)
 
Resource Report
Resource Website 		RRID:Addgene_21224 CaMKIIbeta(A303R) Rattus norvegicus Kanamycin PMID:10102820 Backbone Marker:Clontech; Backbone Size:0; Vector Backbone:C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin CaMKIIbeta(A303R) (Lab plasmid CF 0002) 2026-08-15 01:12:01 0
pHR'-ROMK1-CITE-GFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21322 ROMK1 Rattus norvegicus Ampicillin PMID:10938328 Backbone Marker:Didier Trono; Backbone Size:10000; Vector Backbone:pHR'; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:12:02 1
pLLU2G-Dazl1
 
Resource Report
Resource Website 		RRID:Addgene_21621 Dazl shRNA-1 Rattus norvegicus Ampicillin Dazl shRNA sequence is - 5'-TTTGGGCTATGGATTTGTCTCATTCAAGAGATGAGACAAATCCATAGCCCTTTT Backbone Size:8264; Vector Backbone:pLLU2G; Vector Types:Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin 2026-08-15 01:12:03 0
pCMV5-FLAG-Gene33
 
Resource Report
Resource Website 		RRID:Addgene_21633 Gene33 Rattus norvegicus Ampicillin PMID:10749885 Plasmid was also used in Xu et al. 2005 the construct can be used in cardiomyocytes There is a V to L amino acid change at position 6. The lab feels it is conservative enough not to matter. Backbone Marker:Dr. David Russell, UTSW; Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:04 0
myc-mTOR (1271-2008 aa)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21746 mTOR (1271-2008) Rattus norvegicus Ampicillin PMID:12718876 Backbone Marker:BD Pharmingen; Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin amino acids 1271-2008 2026-08-15 01:12:05 2
pLenti CMV GSE T329A Hygro (w189-4)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22255 Genetic suppressor element #22, T329A Rattus norvegicus Ampicillin Encodes amino acids #312-391 of rat p53 to act as a dominant-negative (Ossovskaya et al. 1996, PNAS 93:10309-10314). T329A mutation does not prevent tetramerization of p53 (Mateu et al. Nat Struct Biol. 1999 Feb;6(2):191-8). Backbone Size:8712; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Threonine 329 is mutated to Alanine (p53 nomencature). 2026-08-15 01:12:10 3
pEGFPC1-EPSIN 1
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_22228 Epsin 1 Rattus norvegicus Kanamycin PMID:9723620 Please note: Addgene's quality control sequence found the EPSIN1 gene has an insertion of threonine after aa 821 and since there is no stop codon, ESPIN1 contains the additional c terminal residues VDGTAGPGSTGSR. The depositor noted that these discrepancies do NOT affect plasmid function. Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin please see depositor comment below 2026-08-15 01:12:09 10
pcDNA3.1-P2X2-YFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22400 ATP-gated P2X channel 2 Rattus norvegicus Ampicillin PMID:16033901 Backbone Marker:Invitrogen; Backbone Size:5600; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:11 1
RSV CREB
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22394 CREB Rattus norvegicus Ampicillin PMID:2573431 insert can be released by digesting with HindIII/Xba1 Backbone Size:3600; Vector Backbone:RSV-SG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:11 6
RSV CREB M1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_22395 CREB Rattus norvegicus Ampicillin PMID:2573431 Backbone Size:3600; Vector Backbone:RSV-SG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Changed Serine 133 to Alanine 2026-08-15 01:12:11 2
pBABEpuro GFP-LC3
 
Resource Report
Resource Website
50+ mentions 		RRID:Addgene_22405 microtubule-associated protein 1 light chain 3 beta Rattus norvegicus Ampicillin PMID:18094039 LC3, a mammalian homologue of yeast Apg8p, is localized in autophagosome membranes after processing. Kabeya Y et al. (EMBO J. 2000 Nov 1. 19(21):5720-8. Backbone Marker:Addgene plasmid # 1764; Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:12:11 98
pCIS-krPAM2
 
Resource Report
Resource Website 		RRID:Addgene_25457 PAM2 Rattus norvegicus Ampicillin PMID:1577852 Backbone Size:0; Vector Backbone:pCIS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Exon A deleted (exon A extends from nt 1475 to nt 1789 and corresponds to aa393-497). 2026-08-15 01:12:41 0
pEAK10-His-Myc-Kal9
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_25441 Kal9 Rattus norvegicus Ampicillin PMID:10777487 There are 2 mutations in the sequence, T46S and N62Y. These sequencing errors are the result of mistakes in initial submission to GenBank by the depositing lab. The sequence should be correct. Backbone Size:6000; Vector Backbone:pEAK-His-Myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:41 3
YFP-NavII-III
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26056 Nav1.2 Rattus norvegicus Kanamycin PMID:20543823 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEYFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin The insert codes only for the intracellular loop between transmembrane domains II and III 2026-08-15 01:12:50 6
pcDNA3-AU1-mTOR-R2505P
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26038 mammalian target of rapamycin-R2505P Rattus norvegicus Ampicillin PMID:20190810 Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin R2505P 2026-08-15 01:12:50 1
pcDNA3-AU1-mTOR-S2215Y
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_26037 mammalian target of rapamycin-S2215Y Rattus norvegicus Ampicillin PMID:20190810 Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin S2215Y 2026-08-15 01:12:47 3
CMV::ratSyGCaMP2
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_26124 Synaptophysin GCaMP2 Rattus norvegicus Kanamycin PMID:19898484 ORF frame 3 (624-2915): Rat SyGCaMP2. Our sequence with CMV-F shows a mutation S199T in Synaptophysin ORF. This change does not have any effect in localizing the construct to the synaptic vesicle and may be a result of a SNP. Backbone Size:3957; Vector Backbone:pEGFP-N1 (Clontech); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:12:48 10
pORANGE GFP-Grin2a KI
 
Resource Report
Resource Website 		RRID:Addgene_131486 gRNA and GFP donor Rattus norvegicus Ampicillin PMID:32275651 Backbone Size:9322; Vector Backbone:pORANGE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:05:18 0
pORANGE GFP-CADPS KI
 
Resource Report
Resource Website 		RRID:Addgene_131482 gRNA and GFP donor Rattus norvegicus Ampicillin PMID:32275651 Backbone Size:9261; Vector Backbone:pORANGE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:05:18 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

dkNET community events and announcements in August, 2026

HIRN Funding Opportunity: SPARKS Award

Join the Whole Person Physiome 1st Data Jamboree on August 24-25

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch