Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: TALE Nuclease, NN for 0.5 repeat
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:22222791
Proper citation: RRID:Addgene_32191 Copy
Genetic Insert: TALE Nuclease, HD for 0.5 repeat
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:22222791
Proper citation: RRID:Addgene_32192 Copy
Genetic Insert: TALE Transcriptional Activator Backbone, HD for 0.5 repeat
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:22222791
Proper citation: RRID:Addgene_32188 Copy
Genetic Insert: TALE Nuclease, NI for 0.5 repeat
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:22222791
Proper citation: RRID:Addgene_32189 Copy
Genetic Insert: TALE Transcriptional Activator Backbone, NG for 0.5 repeat
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:22222791
Proper citation: RRID:Addgene_32186 Copy
Genetic Insert: ccdB
Vector Backbone Description: Vector Backbone:pBSC5; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21931740
Comments: Please see http://www.everyvector.com/sequences/show_public/12784 for additional plasmid map.
Proper citation: RRID:Addgene_32317 Copy
Vector Backbone Description: Backbone Marker:Mo Bi Tec; Vector Backbone:PET01; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:18930792
Proper citation: RRID:Addgene_32485 Copy
Vector Backbone Description: Backbone Size:7032; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21418658
Comments: The full plasmid sequence was assembled and may contain minor discrepancies that should not effect the function of the plasmid.
Proper citation: RRID:Addgene_32683 Copy
Species: phage phiC31
Genetic Insert: phiC31 attB site
Vector Backbone Description: Backbone Size:4670; Vector Backbone:pDEST; Vector Types:Drosophila transgenesis; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: Gateway destination vector with phiC31 attB site, for Drosophila transformation into attP landing sites.
Proper citation: RRID:Addgene_30325 Copy
Species: Synthetic
Genetic Insert: REL2N91/ccdB
Vector Backbone Description: Vector Backbone:pGP4G; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:32123041
Proper citation: RRID:Addgene_188444 Copy
Vector Backbone Description: Vector Backbone:pDEST tol2; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:26445458
Proper citation: RRID:Addgene_188701 Copy
Vector Backbone Description: Vector Backbone:pDEST-P4-P3; Vector Types:Multisite Gateway [4-3] Destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:34748534
Proper citation: RRID:Addgene_188887 Copy
Vector Backbone Description: Backbone Marker:PMID: 7720076; Backbone Size:4885; Vector Backbone:injection vector pRN3; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:17878951
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. The injection vector pRN3 was modified to give rise to pSPE3 by inserting a new polylinker EcoR1-Stu1-Pme1-EcoRV-Not1 (GAATTCAGGCCTTTGTTTAAACTTAGATATCGCGGCCGC) between the EcoR1 and Not1 sites.
Proper citation: RRID:Addgene_186370 Copy
Vector Backbone Description: Backbone Size:5577; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of N terminal mScarlet-I tag at Bgl II/Stu I restriction site
Proper citation: RRID:Addgene_186383 Copy
Vector Backbone Description: Backbone Size:5583; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of C terminal mClover3 tag at EcoR V/Avr II restriction site
Proper citation: RRID:Addgene_186389 Copy
Vector Backbone Description: Backbone Size:5796; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of C terminal emiRFP703 tag at EcoR V/Avr II restriction site
Proper citation: RRID:Addgene_186386 Copy
Vector Backbone Description: Backbone Size:5427; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of N terminal Snap-tag tag at Bgl II/Stu I restriction site
Proper citation: RRID:Addgene_186385 Copy
Vector Backbone Description: Backbone Size:5598; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of N terminal mVenus tag at Bgl II/Stu I restriction site
Proper citation: RRID:Addgene_186384 Copy
Vector Backbone Description: Backbone Size:5574; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of C terminal mNeonGreen tag at EcoR V/Avr II restriction site
Proper citation: RRID:Addgene_186392 Copy
Vector Backbone Description: Backbone Size:5547; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of C terminal mEos4b tag at EcoR V/Avr II restriction site
Proper citation: RRID:Addgene_186390 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
