Plasmids   Select Another Resource Report Type

http://www.addgene.org/49042

Vector Backbone Description: Backbone Marker:Joung Lab; Backbone Size:8550; Vector Backbone:unknown; Vector Types:Mammalian Expression, TALE LSD1 Expression Vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24013198

Proper citation: RRID:Addgene_49042 Copy   

•   Source: Addgene

http://www.addgene.org/48993

Genetic Insert: aminoglycoside 3' phosphotransferase
Vector Backbone Description: Backbone Marker:Life Technologies (Invitrogen); Backbone Size:2500; Vector Backbone:pDONR221; Vector Types:Gateway attB1 & attB2; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19432966
Comments: Please note that Addgene's sequencing results found a few differences when compared to the full plasmid sequence provided by the depositing laboratory. According to the depositing laboratory, these differences are not a concern for the function of the plasmid.

Proper citation: RRID:Addgene_48993 Copy   

•   Source: Addgene

http://www.addgene.org/49048

Species: Bos taurus
Genetic Insert: Enteropeptidase, peptidase domain
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5708; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24184090

Proper citation: RRID:Addgene_49048 Copy   

•   Source: Addgene

http://www.addgene.org/48991

Vector Backbone Description: Backbone Marker:Dankort lab, unpublished; Backbone Size:7435; Vector Backbone:gQxiPuro; Vector Types:Retroviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24146852

Proper citation: RRID:Addgene_48991 Copy   

•   Source: Addgene

http://www.addgene.org/49046

Species: Homo sapiens
Genetic Insert: SUMO1
Vector Backbone Description: Backbone Marker:DNA2.0; Vector Backbone:pJexpress609; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_49046 Copy   

•   Source: Addgene

http://www.addgene.org/49045

Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2734; Vector Backbone:pCR8GWTOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23979020
Comments: Clone sgRNA spacer into BbsI site. Sequence using LKO5' primer: GACTATCATATGCTTACCGT This vector can be transfected, or transferred to a gateway destination vector ( http://www.lifetechnologies.com/us/en/home/life-science/cloning/gateway-cloning/gateway-destination-vectors.html ), or the U6-sgRNA-terminator fragment can be PCR-amplified and transfected as linear DNA. Another template for such linear DNA is one of the dual expression vectors: http://www.addgene.org/48240/ http://www.addgene.org/48239/ http://www.addgene.org/48238/ http://www.addgene.org/48236/ For more information including protocols and updates, please go to http://www.crispr-on.org

Proper citation: RRID:Addgene_49045 Copy   

•   Source: Addgene

http://www.addgene.org/48985

Species: Other
Genetic Insert: hygromycin phosphotransferase
Vector Backbone Description: Backbone Marker:Dankort Lab; Vector Backbone:pBEG R2+xL3 (Addgene plasmid 48952); Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24146852

Proper citation: RRID:Addgene_48985 Copy   

•   Source: Addgene

http://www.addgene.org/48983

Vector Backbone Description: Vector Backbone:pUC; Vector Types:Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24376751
Comments: This plasmid contains a wild-type loxP site and a mutant loxP site termed loxM3. Addgene's mapping software can not differentiate between the two sites and identifies the loxM3 site as loxP. The locations of the loxP and loxM3 sites are: loxP = 3859-3892 loxM3 = 4141-4174

Proper citation: RRID:Addgene_48983 Copy   

•   Source: Addgene

http://www.addgene.org/48989

Vector Backbone Description: Vector Backbone:pUC; Vector Types:Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24376751
Comments: This plasmid contains a wild-type loxP site and a mutant loxP site termed loxM3. Addgene's mapping software can not differentiate between the two sites and identifies the loxM3 site as loxP. The locations of the loxP and loxM3 sites are: loxP = 3859-3892 loxM3 = 4131-4164

Proper citation: RRID:Addgene_48989 Copy   

•   Source: Addgene

http://www.addgene.org/48988

Vector Backbone Description: Vector Backbone:pUC; Vector Types:Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24376751
Comments: This plasmid contains a wild-type loxP site and a mutant loxP site termed loxM3. Addgene's mapping software can not differentiate between the two sites and identifies the loxM3 site as loxP. The locations of the loxP and loxM3 sites are: loxP = 3859-3892 loxM3 = 4755-4788

Proper citation: RRID:Addgene_48988 Copy   

•   Source: Addgene

http://www.addgene.org/48987

Species: Other
Genetic Insert: puromycin resistance
Vector Backbone Description: Backbone Marker:Dankort Lab; Vector Backbone:pBEG R2+xL3 (Addgene plasmid 48952); Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24146852
Comments: Please note that Addgene's sequencing results identified a few sequencing differences when compared to the full plasmid sequence provided by the depositing laboratory. According to the depositing lab, these differences are not a concern for the function of the plasmid.

Proper citation: RRID:Addgene_48987 Copy   

•   Source: Addgene

http://www.addgene.org/49033

Vector Backbone Description: Backbone Marker:Lorenz et al, 1996 (PubMed ID: 8917596); Backbone Size:5306; Vector Backbone:pTLN; Vector Types:Xenopus oocytes expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21410291
Comments: Constructed by Dr. Iwan Zimmermann, Dutzler lab, Dept of Biochemistry, University of Zurich, Switzerland.

Proper citation: RRID:Addgene_49033 Copy   

•   Source: Addgene

http://www.addgene.org/49031

Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6578; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21410291
Comments: Constructed by Dr. Stephan Schenck, Dutzler lab, Dept of Biochemistry, University of Zurich, Switzerland.

Proper citation: RRID:Addgene_49031 Copy   

•   Source: Addgene

http://www.addgene.org/48982

Genetic Insert: blasticidin-S deaminase
Vector Backbone Description: Backbone Marker:Dankort Lab; Vector Backbone:pBEG R2+xL3 (Addgene plasmid 48952); Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24146852

Proper citation: RRID:Addgene_48982 Copy   

•   Source: Addgene

http://www.addgene.org/48981

Vector Backbone Description: Vector Backbone:pUC; Vector Types:Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24376751
Comments: This plasmid contains a wild-type loxP site and a mutant loxP site termed loxM3. Addgene's mapping software can not differentiate between the two sites and identifies the loxM3 site as loxP. The locations of the loxP and loxM3 sites are: loxP = 3859-3892 loxM3 = 4074-4107

Proper citation: RRID:Addgene_48981 Copy   

•   Source: Addgene

http://www.addgene.org/48975

Vector Backbone Description: Vector Backbone:pUC; Vector Types:Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24376751
Comments: This plasmid contains a wild-type loxP site and a mutant loxP site termed loxM3. Addgene's mapping software can not differentiate between the two sites and identifies the loxM3 site as loxP. The locations of the loxP and loxM3 sites are: loxP = 3859-3892 loxM3 = 3987-4020

Proper citation: RRID:Addgene_48975 Copy   

•   Source: Addgene

http://www.addgene.org/48974

Vector Backbone Description: Backbone Marker:Malcolm Moore lab; Vector Backbone:pUltra; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Comments: AmCyan1 excitation and emission maxima are 458 and 489 nm, respectively

Proper citation: RRID:Addgene_48974 Copy   

•   Source: Addgene

http://www.addgene.org/49028

Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5855; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21410291
Comments: Constructed by Dr. Stephan Schenck, Dutzler lab, Dept of Biochemistry, University of Zurich, Switzerland.

Proper citation: RRID:Addgene_49028 Copy   

•   Source: Addgene

http://www.addgene.org/48972

Species: Synthetic
Genetic Insert: 3xFNLDD
Vector Backbone Description: Backbone Marker:Toshio Kitamura; Backbone Size:5994; Vector Backbone:pMXs-IG; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25607658

Proper citation: RRID:Addgene_48972 Copy   

•   Source: Addgene

http://www.addgene.org/49027

Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:8362; Vector Backbone:pYES2/CT; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21410291
Comments: Constructed by Dr. Stephan Schenck, Dutzler lab, Dept of Biochemistry, University of Zurich, Switzerland. The ampicillin resistance cassette is located at bp# 4361-5221.

Proper citation: RRID:Addgene_49027 Copy   

•   Source: Addgene