Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pJZC48 Resource Report Resource Website |
RRID:Addgene_62336 | sgRNA + 1x COM binding module | Ampicillin | PMID:25533786 | Vector Backbone:MP177_U6 (derived from pSico); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | Targets Tet3G, sequence: GTACGTTCTCTATCACTGATA | 2026-08-15 01:17:52 | 0 | ||
|
pDSAT Resource Report Resource Website |
RRID:Addgene_62290 | Kanamycin | PMID:25869647 | Backbone Marker:Invitrogen; Backbone Size:5147; Vector Backbone:pDONR P4r-P3r; Vector Types:Insect Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:17:51 | 0 | ||||
|
pDSAY Resource Report Resource Website 1+ mentions |
RRID:Addgene_62291 | Kanamycin | PMID:25869647 | Backbone Marker:Invitrogen; Backbone Size:5147; Vector Backbone:pDONR P4r-P3r; Vector Types:Insect Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:17:51 | 2 | ||||
|
pDSAR Resource Report Resource Website 1+ mentions |
RRID:Addgene_62292 | Kanamycin | PMID:25869647 | Backbone Marker:Invitrogen; Backbone Size:5103; Vector Backbone:pDONR P4r-P3r; Vector Types:Insect Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:17:51 | 1 | ||||
|
pJZC33 Resource Report Resource Website |
RRID:Addgene_62330 | sgRNA + 2x MS2 binding module | Ampicillin | PMID:25533786 | Vector Backbone:MP177_U6 (derived from pSico); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | Targets Tet3G, sequence: GTACGTTCTCTATCACTGATA | 2026-08-15 01:17:52 | 0 | ||
|
pENTR R4-vas2-integrase-R3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_62299 | phageC31 integrase under control of vasa promoter and terminator | Streptomyces phage C31 | Kanamycin | PMID:25869647 | Backbone Marker:Invitrogen; Backbone Size:2700; Vector Backbone:pDONR P4r-P3r; Vector Types:Insect Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:17:51 | 4 | ||
|
pBSKΔB-CAG-MCP-tdiRFP670-IRES-Neo Resource Report Resource Website |
RRID:Addgene_62345 | MCP-tdiRFP670 | Synthetic | Ampicillin | PMID:26092696 | Vector Backbone:pBlueScript II SK (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:52 | 0 | ||
|
pBSKΔB- CAG-rtTA2sM2-IRES-tTSkid-IRES-Neo Resource Report Resource Website 1+ mentions |
RRID:Addgene_62346 | rtTA2sM2-IRES-tTSkid | Synthetic | Ampicillin | PMID:26092696 | Vector Backbone:pBlueScript II SK (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:52 | 1 | ||
|
pJZC74 Resource Report Resource Website 1+ mentions |
RRID:Addgene_62342 | sgRNA + 1x COM binding module | Ampicillin | PMID:25533786 | Vector Backbone:MP177_U6 (derived from pSico); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | Targets sv40 promoter, sequence: GAATAGCTCAGAGGCCGAGG | 2026-08-15 01:17:52 | 1 | ||
|
pJZC116 Resource Report Resource Website 1+ mentions |
RRID:Addgene_62344 | sgRNA + 2x MS2 (wt+f6) binding module | Ampicillin | PMID:25533786 | Vector Backbone:MP177_U6 (derived from pSico); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | Targets CXCR4 , sequence: GCAGACGCGAGGAAGGAGGGCGC | 2026-08-15 01:17:52 | 1 | ||
|
pBoPyV2a-S22 Resource Report Resource Website |
RRID:Addgene_62356 | Full genome of BoPyV2a isolate S22 | Viruses (Polyomaviridae) | Bleocin (Zeocin) | PMID:25568187 | Genome can be liberated by digestion with SacII | Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Viral clone; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:17:52 | 0 | |
|
pJW1504 Resource Report Resource Website |
RRID:Addgene_62358 | RPS2 fragment | Saccharomyces cerevisiae | Ampicillin | PMID:25378630 | Backbone Size:4373; Vector Backbone:pRS306; Vector Types:yeast targeting; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:52 | 0 | ||
|
pJW1505 Resource Report Resource Website |
RRID:Addgene_62359 | RPL16A | Saccharomyces cerevisiae | Ampicillin | PMID:25378630 | Vector Backbone:pRS306; Vector Types:yeast tagging; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:52 | 0 | ||
|
p28BIOH-LIC Resource Report Resource Website 1+ mentions |
RRID:Addgene_62352 | Kanamycin | GenBank accession: EF442785 | Backbone Marker:Structural Genomics Consortium; Backbone Size:7373; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:17:52 | 2 | ||||
|
pTV-Oct4-TK-HMS Resource Report Resource Website |
RRID:Addgene_62351 | TK-Hyg-24xMS2 | Mus musculus | Ampicillin | PMID:26092696 | Backbone Size:6395; Vector Backbone:pBlueScript II SK (+); Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:52 | 0 | ||
|
MXS_mAzamiGreen Resource Report Resource Website |
RRID:Addgene_62404 | mAzamiGreen | Synthetic | Ampicillin | PMID:25909630 | Backbone Marker:Neveu lab, Addgene plasmid #62394; Backbone Size:1945; Vector Backbone:MXS_chaining vector; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:52 | 0 | ||
|
pBoPyV3-S22 Resource Report Resource Website |
RRID:Addgene_62368 | Full genome of BoPyV3 isolate S22 | Viruses (Polyomaviridae) | Bleocin (Zeocin) | PMID:25568187 | Genome can be liberated by digestion with EcoRI | Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Viral clone; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:17:52 | 0 | |
|
MXS_Cerulean Resource Report Resource Website |
RRID:Addgene_62401 | Cerulean | Synthetic | Ampicillin | PMID:25909630 | Backbone Marker:Neveu lab, Addgene plasmid #62394; Backbone Size:1945; Vector Backbone:MXS_chaining vector; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:52 | 0 | ||
|
pBoPyV3-S23 Resource Report Resource Website |
RRID:Addgene_62369 | Full genome of BoPyV3 isolate S23 | Viruses (Polyomaviridae) | Bleocin (Zeocin) | PMID:25568187 | Genome can be liberated by digestion with EcoRI | Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Viral clone; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-15 01:17:52 | 0 | |
|
pJW1511 Resource Report Resource Website |
RRID:Addgene_62365 | Puro-T2A-AVITEVHAmmuRPL10A | Mus musculus | Ampicillin | PMID:25378630 | Vector Backbone:pMK1047; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:52 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.