Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Issues Status:no known issues (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

740,017 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pFBOH-MHL
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_62304 Ampicillin The pFBOH-MHL vector is a derivative of the pFBOH-LIC vector (SGC). It is a donor vector for generation of recombinant baculovirus by site-specific transposition in an E. coli host. This vector adds an 18 amino acid N-terminal fusion tag containing a 6X His followed by a TEV cleavage site. Two stop codons are included in the vector at the C-terminal cloning site. Insertion of a DNA sequence into the cloning/expression region is performed using Clontech’s In-fusion enzyme mediated directional recombination between complementary 15 nucleotide DNA sequences at the ends of the insert (PCR product) and BseRI linearized vector. Insertion of a target sequence involves replacement of a SacB gene stuffer sequence, which provides for negative selection of the original plasmid on 5% sucrose. Backbone Marker:Structural Genomics Consortium; Backbone Size:6767; Vector Backbone:pFBOH-MHL; Vector Types:Baculovirus expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:51 3
pJW1516
 
Resource Report
Resource Website
RRID:Addgene_62386 OSM1-EGFP fusion Saccharomyces cerevisiae Ampicillin PMID:25378625 Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin Methionine 1 to Alanine 2026-08-15 01:17:52 0
pJW1517
 
Resource Report
Resource Website
RRID:Addgene_62387 OSM1-EGFP fusion Saccharomyces cerevisiae Ampicillin PMID:25378625 Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin Methionine 33 mutated to Alanine 2026-08-15 01:17:52 0
pJW1518
 
Resource Report
Resource Website
RRID:Addgene_62388 mCherry-BirA Other Ampicillin PMID:25378625 Vector Backbone:pFA6a; Vector Types:yeast c-terminal tagging vector; Bacterial Resistance:Ampicillin 2026-08-15 01:17:52 0
pJW1513
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_62383 su9-tagBFP Synthetic Ampicillin PMID:25378625 Vector Backbone:pRS316; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:52 3
pJW1514
 
Resource Report
Resource Website
RRID:Addgene_62384 tev 3x FLAG Synthetic Kanamycin PMID:25378625 Backbone Size:3519; Vector Backbone:pCRII blunt topo; Vector Types:yeast c-terminal tagging vector; Bacterial Resistance:Kanamycin 2026-08-15 01:17:52 0
pJZC603
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_62317 sgRNA + 2x PP7 RNA binding module Ampicillin PMID:25533786 Vector Backbone:pRS416; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:51 2
pJZC572
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_62318 sgRNA + 1x com RNA binding module Ampicillin PMID:25533786 Vector Backbone:pRS416; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:52 1
pJZC545
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_62313 sgRNA + 1x MS2 binding module Ampicillin PMID:25533786 Vector Backbone:pRS416; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:51 2
pJZC583
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_62314 sgRNA + 2x MS2 binding module Ampicillin PMID:25533786 Vector Backbone:pRS416; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:51 1
MXS_MCS3
 
Resource Report
Resource Website
RRID:Addgene_62397 MluI-XhoI-HindIII-PstI-SalI MCS Synthetic Ampicillin PMID:25909630 Backbone Marker:Neveu lab, Addgene plasmid #62394; Backbone Size:1945; Vector Backbone:MXS_chaining vector; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:17:52 0
MXS_MCS4
 
Resource Report
Resource Website
RRID:Addgene_62398 MluI-XhoI-PvuII-BglII-SalI MCS Synthetic Ampicillin PMID:25909630 Backbone Marker:Neveu lab, Addgene plasmid #62394; Backbone Size:1945; Vector Backbone:MXS_chaining vector; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:17:52 0
MXS_chaining vector
 
Resource Report
Resource Website
RRID:Addgene_62394 Ampicillin PMID:25909630 Backbone Size:1945; Vector Backbone:Custom Backbone; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:17:52 0
pJZC32
 
Resource Report
Resource Website
RRID:Addgene_62327 sgRNA Ampicillin PMID:25533786 Vector Backbone:MP177_U6 (derived from pSico); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Targets Tet3G, sequence: GTACGTTCTCTATCACTGATA 2026-08-15 01:17:52 0
pJZC25
 
Resource Report
Resource Website
RRID:Addgene_62328 sgRNA + 1x MS2 binding module Ampicillin PMID:25533786 Vector Backbone:MP177_U6 (derived from pSico); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Targets Tet3G, sequence: GTACGTTCTCTATCACTGATA 2026-08-15 01:17:52 0
pACYC-GST
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_62329 Chloramphenicol Backbone Marker:Structural Genomics Consortium; Backbone Size:8362; Vector Backbone:pACYC-LIC+; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-08-15 01:17:52 1
pJZC35
 
Resource Report
Resource Website
RRID:Addgene_62325 sgRNA Ampicillin PMID:25533786 Vector Backbone:MP177_U6 (derived from pSico); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:17:52 0
pDSAG
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_62289 Kanamycin PMID:25869647 Backbone Marker:Invitrogen; Backbone Size:5144; Vector Backbone:pDONR P4r-P3r; Vector Types:Insect Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:17:51 3
pJZC77
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_62338 sgRNA Ampicillin PMID:25533786 Vector Backbone:MP177_U6 (derived from pSico); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Targets sv40 promoter, sequence: CATACTTCTGCCTGCTGGGGAGCCTG 2026-08-15 01:17:52 1
pJZC40
 
Resource Report
Resource Website
RRID:Addgene_62334 sgRNA + 2x PP7 Ampicillin PMID:25533786 Vector Backbone:MP177_U6 (derived from pSico); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Targets Tet3G, sequence: GTACGTTCTCTATCACTGATA 2026-08-15 01:17:52 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.