Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pCF CREB Resource Report Resource Website 10+ mentions |
RRID:Addgene_22968 | CREB | Rattus norvegicus | Ampicillin | PMID:10825195 | Backbone Size:5000; Vector Backbone:pCF; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:16 | 10 | ||
|
HA-CREST (C89) Resource Report Resource Website |
RRID:Addgene_22961 | CREST | Rattus norvegicus | Ampicillin | Backbone Size:5000; Vector Backbone:pRK5-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:17 | 0 | |||
|
pcDNA3-G4DBD-CREST (C91) Resource Report Resource Website |
RRID:Addgene_22963 | CREST | Rattus norvegicus | Ampicillin | Backbone Size:5000; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:16 | 0 | |||
|
pRK5-HA-LMO4 (L4) Resource Report Resource Website 1+ mentions |
RRID:Addgene_22964 | LMO4 | Rattus norvegicus | Ampicillin | Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:17 | 2 | |||
|
Myc-CREST (C88) Resource Report Resource Website |
RRID:Addgene_22960 | CREST | Rattus norvegicus | Ampicillin | Backbone Size:5000; Vector Backbone:pRK5-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:16 | 0 | |||
|
pCDNA GAL4 CREB 1-341 M1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_22973 | CREB | Rattus norvegicus | Ampicillin | PMID:12718894 | GAL4 DNA-binding domain fused N-terminally to full-length CREB cDNA (aa 4-341) | Backbone Size:5000; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Changed Serine 133 to Alanine of CREB | 2026-08-15 01:12:16 | 1 |
|
pSIN ReP5-GFP-GluR1 Resource Report Resource Website |
RRID:Addgene_24004 | GluR1 | Rattus norvegicus | Ampicillin | PMID:19543281 | Backbone Size:7000; Vector Backbone:pSIN; Vector Types:Sindbis virus production; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:27 | 0 | ||
|
pFLAG ARMS Resource Report Resource Website 1+ mentions |
RRID:Addgene_24086 | ARMS | Rattus norvegicus | Ampicillin | PMID:11150334 | pFLAG-ARMS was generated by ligating two fragments of ARMS- HindIII/KpnI and KpnI/SpeI-- into the HindIII and XbaI sites of pFLAG. The HindIII site was generated by PCR;note that the SpeI and Xba I sites no longer exist after the ligation. | Backbone Size:4700; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:28 | 1 | |
|
pcDNA TrkB Resource Report Resource Website 1+ mentions |
RRID:Addgene_24088 | TrkB | Rattus norvegicus | Ampicillin | PMID:11157096 | Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | R133I | 2026-08-15 01:12:28 | 3 | |
|
pcDNA TrkC Resource Report Resource Website 1+ mentions |
RRID:Addgene_24089 | TrkC | Rattus norvegicus | Ampicillin | PMID:11157096 | Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:29 | 1 | ||
|
TrkA-RFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_24093 | TrkA | Rattus norvegicus | Kanamycin | Backbone Size:5000; Vector Backbone:pDSRed2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | H7L, G21S, V23M, C32S, T39V | 2026-08-15 01:12:29 | 4 | ||
|
TrkC-GFP Resource Report Resource Website |
RRID:Addgene_24094 | TrkC | Rattus norvegicus | Ampicillin | Backbone Size:4000; Vector Backbone:pEGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:28 | 0 | |||
|
shRNA GR Resource Report Resource Website |
RRID:Addgene_24095 | Glucocorticoid Receptor | Rattus norvegicus | Ampicillin | PMID:18347336 | We designed an shRNA targeting the rat GR sequence in the pLentiLox3.7 (ATCC) plasmid carrying a GFP reporter: forward sequence, 5′-tgcgggagaagatgatccattcttcaagagagaatggatcatcttctcccgcttttttgaattc; reverse sequence, 5′-tcgagaattcaaaaaagcgggagaagatgatccattctctcttgaagaatggatcatcttctcccgca. | Backbone Size:7650; Vector Backbone:pLentiLox 3.7; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:28 | 0 | |
|
pCI-SEP-NRI Resource Report Resource Website 1+ mentions |
RRID:Addgene_23999 | NR1 | Rattus norvegicus | Ampicillin | PMID:16481433 | The super-ecliptic pHluorin (SEP) coding sequence was inserted three amino acids downstream of the predicted signal peptide cleavage site. | Backbone Size:4000; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:28 | 9 | |
|
pCI-SEP_NR2A Resource Report Resource Website 1+ mentions |
RRID:Addgene_23997 | NR2A | Rattus norvegicus | Ampicillin | PMID:16481433 | See attached map for additional plasmid features. The super-ecliptic pHluorin (SEP) coding sequence was inserted three amino acids downstream of the predicted signal peptide cleavage site. | Backbone Size:4000; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:26 | 9 | |
|
pCI-SEP_NR2B Resource Report Resource Website 10+ mentions |
RRID:Addgene_23998 | NR2B | Rattus norvegicus | Ampicillin | PMID:16481433 | See attached map for additional plasmid features. The super-ecliptic pHluorin (SEP) coding sequence was inserted three amino acids downstream of the predicted signal peptide cleavage site. | Backbone Size:4000; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:26 | 12 | |
|
RSV-Pit1 Resource Report Resource Website |
RRID:Addgene_24059 | Pit1 | Rattus norvegicus | Ampicillin | PMID:2284007 | Backbone Size:7000; Vector Backbone:pRSV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:28 | 0 | ||
|
sq5 Resource Report Resource Website 1+ mentions |
RRID:Addgene_24499 | Gs alpha | Rattus norvegicus | Ampicillin and Tetracycline | PMID:8863834 | This is Gs alpha with the C-terminal amino acids changed from Gs alpha to Gq alpha residues (QYELL to EYNLV). This construct allows some Gq-coupled receptors to stimulate Adenylate cyclase. There isn't much experience with this chimera at the moment. It may be useful for people who find the AC stimulation is better readout of receptor activation than PLC stimulation. Contains an internal hemaglutinin epitope tage (DVPDYA) that has no effect on receptor coupling. Please see supplemental document for G-protein chimera user manual. | Backbone Size:4000; Vector Backbone:pcDNA1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin and Tetracycline | This is Gs alpha with the C-terminal amino acids changed from Gs alpha to Gq alpha residues (QYELL to EYNLV). | 2026-08-15 01:12:31 | 2 |
|
CMV::SypHy A4 Resource Report Resource Website 10+ mentions |
RRID:Addgene_24478 | SypHy | Rattus norvegicus | Kanamycin | PMID:16982422 | The depositing lab notes that the Xba1 and Bcl1 unique restriction digestion sites could be methylated and blocked if the plasmid is grown or maintained in dam+ bacteria. Also note that in the Addgene-generated map below, the feature listed as "GFP(12-708)" is actually pH sensitive pHluorin. There is a mutation S446T in Synaptophysin ORF. This change does not have any effect in localizing the construct to the synaptic vesicle and may be a result of a SNP. | Backbone Marker:Clontech; Backbone Size:3952; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:12:32 | 16 | |
|
pcDNA3-PKCZeta KR HA Tagged Resource Report Resource Website |
RRID:Addgene_24608 | PKCZeta | Rattus norvegicus | Ampicillin | PMID:14657501 | Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | K281R mutation in the ATP binding domain causing a kinase dead variant. | 2026-08-15 01:12:32 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.