Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pAS-8 (seed1-8) Resource Report Resource Website |
RRID:Addgene_40843 | let-7–seed1-8 | Drosophila melanogaster | Kanamycin | PMID:20558712 | The let-7 seed1-8 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos: s: CTAGATAACACGTTGGCTCTACCTCAT as: CTAGATGAGGTAGAGCCAACGTGTTAT | Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:39 | 0 | |
|
pAS14 (mm16-21) Resource Report Resource Website |
RRID:Addgene_40849 | let-7–mm16-21 | Drosophila melanogaster | Kanamycin | PMID:20558712 | The let-7 mm16-21 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos: s: CTAGATGACACCAACCTACTACCTCAT as: CTAGATGAGGTAGTAGGTTGGTGTCAT | Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:39 | 0 | |
|
pAS-13 Resource Report Resource Website |
RRID:Addgene_40848 | let-7–Bartel | Drosophila melanogaster | Kanamycin | PMID:20558712 | The let-7 Bartel complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos: s: CTAGATGATAACAACGATCTACCTCAT as: CTAGATGAGGTAGATCGTTGTTATCAT | Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:39 | 0 | |
|
pAW-EGFP-4xlet-7 (pAW-AS27) Resource Report Resource Website |
RRID:Addgene_40834 | Four target sites perfectly complementary to let-7 | Drosophila melanogaster | Ampicillin | PMID:20558712 | The let-7 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos: s: CTA GAA CTA TAC AAC CTA CTA CCT CAT CTA GAA CTA TAC AAC CTA CTA CCT CAT as: CTA GAT GAG GTA GTA GGT TGT ATA GTT CTA GAT GAG GTA GTA GGT TGT ATA GTT This expression cassette was then sub-cloned into the Gateway vector pAW using GATEWAY cloning. | Backbone Marker:Murhpy Lab, Carnegie Institution for Science; Backbone Size:7233; Vector Backbone:pAW; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:39 | 0 | |
|
pAW-EGFP-2xmiR-1 (pAW-AS-21) Resource Report Resource Website |
RRID:Addgene_40832 | Two target sites perfectly complementary to miR-1 | Drosophila melanogaster | Ampicillin | PMID:20558712 | The miR-1 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos: s: CTA GAC TCC ATA CTT CTT TAC ATT CCA TCT AGA CTC CAT ACT TCT TTA CAT TCC AT as: CTA GAT GGA ATG TAA AGA AGT ATG GAG TCT AGA TGG AAT GTA AAG AAG TAT GGA GT This expression cassette was then sub-cloned into the Gateway vector pAW using GATEWAY cloning. | Backbone Marker:Murhpy Lab, Carnegie Institution for Science; Backbone Size:7233; Vector Backbone:pAW; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:39 | 0 | |
|
psiCheck-2-3 x mir-34 Resource Report Resource Website |
RRID:Addgene_40831 | three sites partially complementary to miR-34 | Drosophila melanogaster | Ampicillin | PMID:22055293 | The psiCheck-3xmiR-34 sequences were cloned by synthesized dsDNA S: 5'-TCGAGGTGTTGATGCTAAGGTCACTGCCAGTGTTGATGCTAAGGTCACTGCCAGTGTTGATGCTAAGGTCACTGCCAGC AS: 5'-GGCCGCTGGCAGTGACCTTAGCATCAACACTGGCAGTGACCTTAGCATCAACACTGGCAGTGACCTTAGCATCAACACC the triple(3x)-repeated sequence: 5'TGGCAGTGACCTTAGCATCAACAC-3' 3'ACCGTCACTGGAATCGTAGTTGTG-5' pairs with dme-miR-34 (uggcagugugguuagcugguugug) with "seed(red) plus 3' complementary region (blue)" fashion. | Backbone Marker:promega; Backbone Size:6273; Vector Backbone:psiCheck-2; Vector Types:Insect Expression, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:39 | 0 | |
|
pAS-4 (mm19-21) Resource Report Resource Website |
RRID:Addgene_40839 | let-7–mm19-21 | Drosophila melanogaster | Kanamycin | PMID:20558712 | The let-7–mm19-21 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos: s: CTAGATGAATACAACCTACTACCTCAT as: CTAGATGAGGTAGTAGGTTGTATTCAT | Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:39 | 0 | |
|
pAS-2 (mm21) Resource Report Resource Website |
RRID:Addgene_40837 | let-7–mm21 | Drosophila melanogaster | Kanamycin | PMID:20558712 | The let-7 mm21 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos: s: CTAGATCTATACAACCTACTACCTCAT as: CTAGATGAGGTAGTAGGTTGTATAGAT | Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:39 | 0 | |
|
pcold-6xHis-HRV3Csite-DmLoqsPA Resource Report Resource Website 1+ mentions |
RRID:Addgene_41093 | Loquacious-PA | Drosophila melanogaster | Ampicillin | PMID:23063653 | Backbone Marker:Takara; Backbone Size:6000; Vector Backbone:pcold1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:41 | 1 | ||
|
pattB-3xFlag-Loqs-PB Resource Report Resource Website |
RRID:Addgene_41109 | Loquacious-PB | Drosophila melanogaster | Ampicillin | PMID:23063653 | Backbone Size:8000; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:42 | 0 | ||
|
pattB-3xFlag-Loqs-PA Resource Report Resource Website |
RRID:Addgene_41108 | Loquacious-PA | Drosophila melanogaster | Ampicillin | PMID:23063653 | Backbone Size:8000; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:42 | 0 | ||
|
pUASTattB_NSlmb-vhhGFP4 Resource Report Resource Website |
RRID:Addgene_35577 | NSlmb-vhhGFP4 | Drosophila melanogaster | Ampicillin | PMID:22157958 | Backbone Size:8500; Vector Backbone:pUASattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:02 | 0 | ||
|
pUAST_NSlmb-vhhGFP4 Resource Report Resource Website |
RRID:Addgene_35575 | NSlmb-vhhGFP4 | Drosophila melanogaster | Ampicillin | PMID:22157958 | Backbone Size:8800; Vector Backbone:pUAS; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:06 | 0 | ||
|
pUASTattB_NSnoFbox-vhhGFP4 Resource Report Resource Website |
RRID:Addgene_35578 | NSnoFbox-vhhGFP4 | Drosophila melanogaster | Ampicillin | PMID:22157958 | Backbone Size:8500; Vector Backbone:pUASattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | F box domain of slmb deleted. | 2026-08-15 01:14:02 | 0 | |
|
OA-1043 Resource Report Resource Website 1+ mentions |
RRID:Addgene_164586 | U6 and DR | Drosophila melanogaster | Ampicillin | PMID:33616113 | Backbone Size:7350; Vector Backbone:white+attB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:22 | 1 | ||
|
pR70B04 Resource Report Resource Website |
RRID:Addgene_165792 | R70B04 | Drosophila melanogaster | Ampicillin | PMID:34525356 | Enhancer | Backbone Size:2955; Vector Backbone:pUPD2; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:31 | 0 | |
|
pDmVasa Resource Report Resource Website |
RRID:Addgene_165783 | Vasa promoter | Drosophila melanogaster | Ampicillin | PMID:34525356 | Promoter | Backbone Size:3057; Vector Backbone:pUPD; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:31 | 0 | |
|
pDmAlfaTub84b Resource Report Resource Website |
RRID:Addgene_165781 | AlfaTub84b | Drosophila melanogaster | Ampicillin | PMID:34525356 | Promoter | Backbone Size:3057; Vector Backbone:pUPD; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:31 | 0 | |
|
pDmHsp70b Resource Report Resource Website |
RRID:Addgene_165785 | Hsp70b | Drosophila melanogaster | Ampicillin | PMID:34525356 | Promoter | Backbone Size:3057; Vector Backbone:pUPD; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:31 | 0 | |
|
pDmHsp70b-TACT Resource Report Resource Website |
RRID:Addgene_165780 | Hsp70b-TACT | Drosophila melanogaster | Ampicillin | PMID:34525356 | Promoter | Backbone Size:2955; Vector Backbone:pUPD2; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:31 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.