Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

740,017 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pCMV4a-hFJX1-Flag
 
Resource Report
Resource Website
RRID:Addgene_46931 FJX1 Homo sapiens Kanamycin Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-Tag 4A; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:36 0
5HRE/GFP
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_46926 5X HRE of VEGF Homo sapiens Ampicillin PMID:11774035 The 35-bp human VEGF HRE sequence is: CCACAGTGCATACGTGGGCTCCAACAGGTCCTCTT The d2EGFP fragment was amplified from a Clontech (Palo Alto, CA) vector and encodes a destabilized red- shifted variant of wild-type GFP with an excitation maximum of 488 nm, an emission maximum of 507 nm, and a half-life of approximately 2 hours. Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pEF/myc/cyto; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin five copies of a 35-bp fragment from the hypoxia-responsive element (HRE) of the human VEGF gene and a human cytomegalovirus minimal promoter 2026-08-15 01:15:37 24
pSNR52-sgTET
 
Resource Report
Resource Website
RRID:Addgene_46923 sgRNA targeting endogenous TRE elements of pTET07 promoter Saccharomyces cerevisiae Ampicillin PMID:23849981 gRNA target sequence TATCAGTGATAGAGAAAAGT Backbone Size:5083; Vector Backbone:AH057; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 0
YFP-Parkin C431N
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46924 Park2 Homo sapiens Kanamycin PMID:23319602 Backbone Marker:Clontech; Backbone Size:4698; Vector Backbone:pEYFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin changed cysteine 431 to asparagine 2026-08-15 01:15:36 2
LZRSMS-GFP-hFJX1-Flag
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46929 FJX1 Homo sapiens Ampicillin Backbone Size:12800; Vector Backbone:LZRS-MS-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 1
pIRES-GFP-hFJX1-myc
 
Resource Report
Resource Website
RRID:Addgene_46928 FJX1 Homo sapiens Ampicillin A 5' EcoRI site and 3' myc tag were added to the FJX1 cDNA by PCR. The fragment was blunt end ligated into an EcoRV site on pIRES-EGFP so there is an additional EcoRI site at 5' end of FJX1. Backbone Marker:Clontech; Backbone Size:5200; Vector Backbone:pIRES-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 0
pMA3288
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46885 Uracil-N-glycosylase WT Homo sapiens Ampicillin PMID:23721969 Backbone Marker:Homemade; Backbone Size:6686; Vector Backbone:pMA2780; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 1
pDL278
 
Resource Report
Resource Website
RRID:Addgene_46882 Spectinomycin PMID:1409970 This plasmid may contain unstable elements. Prolonged growth in E. coli selects for deletions, but not in E. faecalis. Test multiple clones upon to ensure the full plasmid is selected. Backbone Marker:Addgene plasmid 46881; Backbone Size:6733; Vector Backbone:pDL276; Vector Types:Bacterial Expression, Other, E. coli/Gram-positive Bacterial Shuttle Vector; Bacterial Resistance:Spectinomycin 2026-08-15 01:15:36 0
pMSP3535
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46886 Erythromycin PMID:10964628 This plasmid utilizes the NIsin Controlled Expression (NICE) system. NICE® is a registered trademark of NIZO food research BV, P.O.Box 20, 6710 BA Ede, The Netherlands. pMSP3535 contains the Nisin-inducible PnisA promoter, and the pAMB1 replicon for expression in gram-positive bacteria. For protein expression in E. faecalis, induce with 10-25 ng/mL nisin (Sigma, N-5764). See associated article for instructions on how to make nisin solution. Note: Nucleotide sequence encoding the signal sequence and one-third of the mature NisA (nisin) peptide remains associated with the PnisA promoter. The depositing laboratory recommends adding of a Stop codon to the 5' end of inserted sequences to avoid unintentional gene fusions. Addgene's quality control sequencing finds discrepancies with the depositor's provided sequencew which includes a mutation in RepE- F229L. This however is thought to not affect plasmid function. Backbone Size:8353; Vector Backbone:pMSP3535; Vector Types:Bacterial Expression, Nisin-inducible expression; Gram-positive Bacterial Shuttle Vector; Bacterial Resistance:Erythromycin 2026-08-15 01:15:36 6
pMSP3535VA
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46887 Kanamycin PMID:10964628 This plasmid utilizes the NIsin Controlled Expression (NICE) system. NICE® is a registered trademark of NIZO food research BV, P.O.Box 20, 6710 BA Ede, The Netherlands. pMSP3535VA contains the Nisin-inducible PnisA promoter, and the pVA380-1 replicon for expression in gram-positive bacteria. For protein expression in E. faecalis, induce with 10-25 ng/mL nisin (Sigma, N-5764). See associated article for instructions on how to make nisin solution. Note: Nucleotide sequence encoding the signal sequence and one-third of the mature NisA (nisin) peptide remains associated with the PnisA promoter. The depositing laboratory recommends adding of a Stop codon to the 5' end of inserted sequences to avoid unintentional gene fusions. Note: The theoretical full sequence uploaded here is NOT fully accurate - the NheI site at position 4414 has been lost, along with approximately 500bp of sequence in this region (compare the depositor's uploaded maps). The actual size of this plasmid is 8278 as listed here. The depositing lab has not resequenced the region in question, but the discrepancy does not affect plasmid function. Note: This plasmid has been shown to accumulate deletions when replicated in E. coli (or gram-negative bacteria). Screening transformants by restriction digest is recommended. Addgene's quality control sequencing finds discrepancies with the depositor's provided sequence, but they are not thought to affect plasmid function. Backbone Size:8278; Vector Backbone:pMSP3535VA; Vector Types:Bacterial Expression, Nisin-inducible expression; Gram-positive Bacterial Shuttle Vector; Bacterial Resistance:Kanamycin 2026-08-15 01:15:36 1
pTDH3-dCas9
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46920 dCas9 Ampicillin PMID:23849981 The Cas9 contains a N612K mutation that does not effect the function of the enzyme. Backbone Size:6900; Vector Backbone:pJED103; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 7
pMA3174
 
Resource Report
Resource Website
RRID:Addgene_46880 Ampicillin PMID:22637478 Backbone Marker:Homemade; Backbone Size:6990; Vector Backbone:pMA3211; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 0
pU6-sgGFP-NT1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46914 sgGFP-NT1 Ampicillin PMID:23849981 gRNA target sequence GAATAGCTCAGAGGCCGAGG Backbone Marker:Addgene; Backbone Size:8200; Vector Backbone:pSICO derivative; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 8
pU6-sgGAL4-1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46915 sgGAL4-1 Ampicillin PMID:23849981 gRNA target sequence GTTGGAGCACTGTCCTCCGAACGT Backbone Marker:Addgene; Backbone Size:8200; Vector Backbone:pSICO derivative; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 2
pMA3211
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46879 Ampicillin PMID:22637478 Backbone Marker:Homemade; Backbone Size:6642; Vector Backbone:pMA3211; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 1
pMSCV-LTR-dCas9-p65AD-BFP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46913 dCas9-p65AD-BFP fusion Homo sapiens Ampicillin PMID:23849981 Backbone Marker:Clontech; Backbone Size:6300; Vector Backbone:MSCV-puro; Vector Types:Mammalian Expression, Retroviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:37 2
pU6-sgCD71-2
 
Resource Report
Resource Website
RRID:Addgene_46918 sgCD71 -2 Homo sapiens Ampicillin PMID:23849981 gRNA target sequence GGACGCGCTAGTGTGAGTGC Backbone Marker:Addgene; Backbone Size:8200; Vector Backbone:pSICO derivative; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 0
pU6-sgGAL4-4
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46916 sgGAL4-4 Ampicillin PMID:23849981 gRNA target sequence GAACGACTAGTTAGGCGTGTA Backbone Marker:Addgene; Backbone Size:8200; Vector Backbone:pSICO derivative; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:37 1
Beclin-HA S-A
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46994 becn1 Mus musculus Ampicillin PMID:23685627 Vector Backbone:pqcxih; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin S14A 2026-08-15 01:15:37 1
pMA3379
 
Resource Report
Resource Website
RRID:Addgene_46874 soluble guanylate cyclase 1alpha3 Rattus norvegicus Ampicillin PMID:22637478 Please note that though there are some differences between Addgene's quality control sequence and the depositor's assembled sequence, this plasmid should function as reported. Backbone Marker:Homemade; Backbone Size:6642; Vector Backbone:pMA3211; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.