Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: promoter 11 and BCD1
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pFAB1781; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23474465
Comments: http://biofab.org/services
RFP fluorescence (Arbitrary Units, AU) is used to measure the efficiency of the promoter/BCD combination. Promoter/BCD combinations ranged from a low score of 6.14 to a high score of 634.54. The score for this combination was: 122.59
Proper citation: RRID:Addgene_47842 Copy
Species: Synthetic
Genetic Insert: promoter 9 and BCD1
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pFAB1781; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23474465
Comments: http://biofab.org/services
RFP fluorescence (Arbitrary Units, AU) is used to measure the efficiency of the promoter/BCD combination. Promoter/BCD combinations ranged from a low score of 6.14 to a high score of 634.54. The score for this combination was: 69.62
Proper citation: RRID:Addgene_47840 Copy
Species: Synthetic
Genetic Insert: promoter 7 and BCD1
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pFAB1781; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23474465
Comments: http://biofab.org/services
RFP fluorescence (Arbitrary Units, AU) is used to measure the efficiency of the promoter/BCD combination. Promoter/BCD combinations ranged from a low score of 6.14 to a high score of 634.54. The score for this combination was: 404.1
Proper citation: RRID:Addgene_47838 Copy
Species: Synthetic
Genetic Insert: Codon-optimised CLAG3.2
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24043421
Proper citation: RRID:Addgene_47797 Copy
Species: Synthetic
Genetic Insert: promoter 14 and BCD23
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pFAB1781; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23474465
Comments: http://biofab.org/services
RFP fluorescence (Arbitrary Units, AU) is used to measure the efficiency of the promoter/BCD combination. Promoter/BCD combinations ranged from a low score of 6.14 to a high score of 634.54. The score for this combination was: 52.63
Proper citation: RRID:Addgene_47830 Copy
Species: Synthetic
Genetic Insert: promoter 4 and BCD1
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pFAB1781; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23474465
Comments: http://biofab.org/services
RFP fluorescence (Arbitrary Units, AU) is used to measure the efficiency of the promoter/BCD combination. Promoter/BCD combinations ranged from a low score of 6.14 to a high score of 634.54. The score for this combination was: 50.75
Proper citation: RRID:Addgene_47835 Copy
Species: Synthetic
Genetic Insert: Codon-optimised PTRAMP
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24043421
Proper citation: RRID:Addgene_47793 Copy
Species: Synthetic
Genetic Insert: Codon-optimised RAP1
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24043421
Proper citation: RRID:Addgene_47794 Copy
Species: Synthetic
Genetic Insert: Codon-optimised PF3D7_1431400
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24043421
Proper citation: RRID:Addgene_47791 Copy
Species: Synthetic
Genetic Insert: Codon-optimised EBL1
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24043421
Proper citation: RRID:Addgene_47792 Copy
Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2958; Vector Backbone:pBluescript SK+; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23979586
Comments: To generate the unique SpeI site, a short, 37 bp, linker was inserted into an existing NdeI site. This linker seems to have been inserted 2 or more times, creating a short repeat region that we have been unable to sequence across. Sequencing with the M13 reverse primer will fail.
Proper citation: RRID:Addgene_47946 Copy
Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2958; Vector Backbone:pBluescript SK+; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23979586
Comments: To generate the unique SpeI site, a short, 37 bp, linker was inserted into an existing NdeI site. This linker seems to have been inserted 2 or more times, creating a short repeat region that we have been unable to sequence across. Sequencing with the M13 reverse primer will fail.
Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3
Proper citation: RRID:Addgene_47944 Copy
Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2958; Vector Backbone:pBluescript SK+; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23979586
Comments: To generate the unique SpeI site, a short, 37 bp, linker was inserted into an existing NdeI site. This linker seems to have been inserted 2 or more times, creating a short repeat region that we have been unable to sequence across. Sequencing with the M13 reverse primer will fail.
Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3
Proper citation: RRID:Addgene_47945 Copy
Species: Synthetic
Genetic Insert: guide RNA
Vector Backbone Description: Backbone Marker:Geneart; Vector Backbone:pMK; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23979586
Proper citation: RRID:Addgene_47943 Copy
Species: Homo sapiens
Genetic Insert: MOB1A
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19919647
Proper citation: RRID:Addgene_47937 Copy
Species: Homo sapiens
Genetic Insert: CIN85
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16751601
Comments: The CIN85 insert in this plasmid contains a D114G mutation when compared to GenBank accession number NP_114098.1. This mutation was not intentional and was present in the original CIN85 clone.
Proper citation: RRID:Addgene_47935 Copy
Species: Homo sapiens
Genetic Insert: Miro2 A13V
Vector Backbone Description: Backbone Marker:Dr. Alan Hall, MRC-LMCB; Vector Backbone:pRK5-myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16630562
Proper citation: RRID:Addgene_47896 Copy
Species: Homo sapiens
Genetic Insert: Miro2 T18N
Vector Backbone Description: Backbone Marker:Dr. Alan Hall, MRC-LMCB; Vector Backbone:pRK5-myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16630562
Proper citation: RRID:Addgene_47897 Copy
Species: Danio rerio
Genetic Insert: golden gRNA
Vector Backbone Description: Backbone Size:2542; Vector Backbone:pT7-gRNA; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23918387
Comments: For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/
gRNA target sequence GGTCTCTCGCAGGATGTTGC
Proper citation: RRID:Addgene_47930 Copy
Species: Homo sapiens
Genetic Insert: Miro1 E208K/E328K
Vector Backbone Description: Backbone Marker:Dr. Alan Hall, MRC-LMCB; Vector Backbone:pRK5-myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16630562
Proper citation: RRID:Addgene_47894 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
