Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
|||||
|---|---|---|---|---|---|---|---|---|---|---|---|
|
pGEX-αTAT1[2-236] Resource Report Resource Website 1+ mentions |
RRID:Addgene_27101 | αTubulin K40 acetyltransferase | Homo sapiens | Ampicillin | PMID:21068373 | Backbone Size:4981; Vector Backbone:pGEX-6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-17 02:44:09 | 1 | ||
|
PTRF/Cavin1_R (OZ514) Resource Report Resource Website |
RRID:Addgene_27189 | Zinc finger array targeting PTRF/Cavin1 | Danio rerio | Kanamycin | PMID:18657511 | This plasmid encodes a zinc finger array targeting half of a target sequence in the zebrafish gene PTRF/Cavin1 (see below). Please note that this plasmid does NOT contain the PTRF/Cavin1 sequence. Users must order the complementary plasmid PTRF/Cavin1_L (OZ513) [Addgene plasmid 27188] in order to create a zinc finger nuclease (ZFN) pair to introduce targeted mutations into this specific zebrafish gene. Users will also need to clone the zinc finger (ZF) insert of this plasmid into a zinc finger nuclease (ZFN) vector to express a FOKI fusion product. Examples of possible ZFN expression vectors that can be used are: pST1374 (Addgene plasmid 13426), pMLM290 (Addgene plasmid 21872), pMLM292 (Addgene plasmid 21873), pMLM800 (Addgene plasmid 27202) and pMLM802 (Addgene plasmid 27203). This zinc finger array was tested for binding activity to the sequence 5'-GGAGGTGCC-3' in a bacterial two hybrid assay, and resulted in 6.81 fold activation. However, this array has not yet been tested for activity as a zinc finger nuclease (i.e. for its ability to induce mutations at the intended locus). Scientists using this zinc finger array in a publication should notify [email protected] and acknowledge NIH grant number R01 GM088040 in the publication. Other Articles: "Oligomerized pool engineering (OPEN): an 'open-source' protocol for making customized zinc-finger arrays." Maeder ML et al. (Nat Protoc. 2009 Sept 17. 4(10):1471-1501. Pubmed ID: 19798082 "Targeted mutagenesis in zebrafish using customized zinc-finger nucleases." Foley JE et al. (Nat Protoc. 2009 Dec 3. 4(12):1855-1867. Pubmed ID: 20010934 | Backbone Size:5493; Vector Backbone:MG414; Vector Types:Zebrafish Targeting; Bacterial Resistance:Kanamycin | Addgene | 2026-10-17 02:44:10 | 0 | |
|
zgc:153086_R (OZ512) Resource Report Resource Website |
RRID:Addgene_27187 | Zinc finger array targeting zgc:153086 | Danio rerio | Kanamycin | PMID:18657511 | This plasmid encodes a zinc finger array targeting half of a target sequence in the zebrafish gene zgc:153086 (see below). Please note that this plasmid does NOT contain the zgc:153086 sequence. Users must order the complementary plasmid zgc:153086_L (OZ511) [Addgene plasmid 27186] in order to create a zinc finger nuclease (ZFN) pair to introduce targeted mutations into this specific zebrafish gene. Users will also need to clone the zinc finger (ZF) insert of this plasmid into a zinc finger nuclease (ZFN) vector to express a FOKI fusion product. Examples of possible ZFN expression vectors that can be used are: pST1374 (Addgene plasmid 13426), pMLM290 (Addgene plasmid 21872), pMLM292 (Addgene plasmid 21873), pMLM800 (Addgene plasmid 27202) and pMLM802 (Addgene plasmid 27203). This zinc finger array was tested for binding activity to the sequence 5'-GGAGGTGAG-3' in a bacterial two hybrid assay, and resulted in 10.23 fold activation. However, this array has not yet been tested for activity as a zinc finger nuclease (i.e. for its ability to induce mutations at the intended locus). Scientists using this zinc finger array in a publication should notify [email protected] and acknowledge NIH grant number R01 GM088040 in the publication. Other Articles: "Oligomerized pool engineering (OPEN): an 'open-source' protocol for making customized zinc-finger arrays." Maeder ML et al. (Nat Protoc. 2009 Sept 17. 4(10):1471-1501. Pubmed ID: 19798082 "Targeted mutagenesis in zebrafish using customized zinc-finger nucleases." Foley JE et al. (Nat Protoc. 2009 Dec 3. 4(12):1855-1867. Pubmed ID: 20010934 | Backbone Size:5493; Vector Backbone:MG414; Vector Types:Zebrafish Targeting; Bacterial Resistance:Kanamycin | Addgene | 2026-10-17 02:44:10 | 0 | |
|
pGMEH-P38-luxAFB-DAS+4 Resource Report Resource Website |
RRID:Addgene_27064 | P#38-luxA-FLAG-luxB-DAS+4 | synthetic gene | Hygromycin | PMID:21075796 | Backbone Size:7843; Vector Backbone:pDE43-MEH; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin | Addgene | 2026-10-17 02:44:09 | 0 | ||
|
pLKO.1-MKL1/2 shRNA Resource Report Resource Website 1+ mentions |
RRID:Addgene_27161 | shRNA MKL1+2 | Mus musculus | Ampicillin | PMID:20466732 | shRNA sequence for knockdown of both MKL1 and MKL2: CATGGAGCTGGTGGAGAAGAA | Backbone Size:0; Vector Backbone:pLKO.1-puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | Addgene | 2026-10-17 02:44:10 | 5 | |
|
pMSG360 Resource Report Resource Website |
RRID:Addgene_27155 | Hygromycin | PMID:20472794 | Note that Addgene's sequencing results differ from the depositor's sequence at bp# 561, 565 and 829. Depositing scientist states that these differences do not affect the function of the plasmid. | Backbone Marker:Glickman Lab; Backbone Size:4152; Vector Backbone:pmsg360; Vector Types:mycobacterial ko vector; Bacterial Resistance:Hygromycin | Addgene | 2026-10-17 02:44:09 | 0 | |||
|
pCGN-ELK-1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_27156 | ELK1 | Homo sapiens | Ampicillin | PMID:20466732 | Backbone Size:0; Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-17 02:44:09 | 6 | ||
|
pBS-slpGFP Resource Report Resource Website |
RRID:Addgene_27171 | surface (S)-layer protein promoter region fused with modified green fluorescent protein 5 | Lactococcus lactis and synthetic construct | Ampicillin | PMID:20455948 | Backbone Size:2959; Vector Backbone:pBluescript II KS(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-17 02:44:10 | 0 | ||
|
pCMV-BiP-Myc-KDEL P495L Resource Report Resource Website 1+ mentions |
RRID:Addgene_27166 | BiP | Homo sapiens | Ampicillin | PMID:12110171 | Backbone Size:0; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Peptide Binding Mutant: P495L | Addgene | 2026-10-17 02:44:10 | 1 | |
|
pRL-SV40P Resource Report Resource Website 50+ mentions |
RRID:Addgene_27163 | SV40 promoter | Ampicillin | PMID:10373518 | pRL-SV40P was generated by placing the simian virus 40 (SV40) promoter from pGL3-Promoter (Promega) into pRL-TK such that the SV40 promoter is driving the Renilla luciferase gene. | Backbone Marker:Promega; Backbone Size:4045; Vector Backbone:pRL-TK; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | Addgene | 2026-10-17 02:44:10 | 84 | ||
|
pcDNA-FLAG-Nv-NF-kB-Cys Resource Report Resource Website |
RRID:Addgene_27260 | Nv-NF-kB | Nematostella vectensis | Ampicillin | PMID:19806194 | Clone starts at aa 2. | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | "Cys allele" = Cysteine at aa 67 | Addgene | 2026-10-17 02:44:11 | 0 |
|
pcDNA-FLAG-Nv-NF-kB-Ser Resource Report Resource Website |
RRID:Addgene_27259 | Nv-NF-kB | Nematostella vectensis | Ampicillin | PMID:19806194 | Clone starts at aa 2. | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | "Ser allele" = Serine at aa 67 | Addgene | 2026-10-17 02:44:11 | 0 |
|
pcDNA-v-Rel Resource Report Resource Website 1+ mentions |
RRID:Addgene_27256 | v-Rel | Reticuloendotheliosis virus | Ampicillin | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-17 02:44:11 | 1 | |||
|
SG-3'REL Resource Report Resource Website |
RRID:Addgene_27257 | REL | Homo sapiens | Ampicillin | PMID:14534540 | Backbone Size:3396; Vector Backbone:pSG424; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Contains aa 278-587 of REL | Addgene | 2026-10-17 02:44:11 | 0 | |
|
pcDNA-FLAG-Mo-Trip6 Resource Report Resource Website 1+ mentions |
RRID:Addgene_27254 | Trip6 | Mus musculus | Ampicillin | PMID:10395914 | Trip6 cDNA starts at aa 2. | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-17 02:44:11 | 1 | |
|
pcDNA-FLAG-Hu-Trip6 Resource Report Resource Website 1+ mentions |
RRID:Addgene_27255 | Trip6 | Homo sapiens | Ampicillin | PMID:10794523 | Trip6 cDNA contains starts at aa 2. | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-17 02:44:11 | 1 | |
|
pcDNA-FLAG-REL Resource Report Resource Website 1+ mentions |
RRID:Addgene_27253 | REL | Homo sapiens | Ampicillin | PMID:18695674 | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-17 02:44:11 | 7 | ||
|
pGL4.11 promPDE4D3 Ebox mut Resource Report Resource Website |
RRID:Addgene_27304 | prom PDE4D3 | Homo sapiens | Ampicillin | PMID:20952536 | Backbone Size:4370; Vector Backbone:pGL4.11; Vector Types:Luciferase; Bacterial Resistance:Ampicillin | Ebox CACATG changed to GAGATG | Addgene | 2026-10-17 02:44:11 | 0 | |
|
pDEST/N1-hBIN1-GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_27305 | bridging integrator 1 (BIN1), transcript variant 8 | Homo sapiens | Kanamycin | PMID:20169111 | Backbone Size:4700; Vector Backbone:pDEST/N1-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | Addgene | 2026-10-17 02:44:11 | 2 | ||
|
GST-SEPT5 WT Resource Report Resource Website |
RRID:Addgene_27269 | Septin 5 | Homo sapiens | Ampicillin | PMID:18385322 | Backbone Marker:GE Healthcare Life Sciences; Backbone Size:4985; Vector Backbone:pGEX6P-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-17 02:44:11 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
