Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
On page 23 showing 441 ~ 460 out of 443,797 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:Addgene_39731

http://www.addgene.org/39731

Species: Drosophila melanogaster
Genetic Insert: CG14441
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22037703
Comments: Please note that the ORFs in this collection were cloned open-ended (without a stop codon).

Proper citation: RRID:Addgene_39731 Copy   

    • RRID:Addgene_39726

http://www.addgene.org/39726

Species: Drosophila melanogaster
Genetic Insert: CG14513
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22037703
Comments: Please note that the ORFs in this collection were cloned open-ended (without a stop codon).

Proper citation: RRID:Addgene_39726 Copy   

    • RRID:Addgene_39727

http://www.addgene.org/39727

Species: Drosophila melanogaster
Genetic Insert: CG12075
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22037703
Comments: Please note that the ORFs in this collection were cloned open-ended (without a stop codon).

Proper citation: RRID:Addgene_39727 Copy   

    • RRID:Addgene_39722

http://www.addgene.org/39722

Species: Drosophila melanogaster
Genetic Insert: CG6312
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22037703
Comments: Please note that the ORFs in this collection were cloned open-ended (without a stop codon).

Proper citation: RRID:Addgene_39722 Copy   

    • RRID:Addgene_39723

http://www.addgene.org/39723

Species: Drosophila melanogaster
Genetic Insert: CG6883
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22037703
Comments: Please note that the ORFs in this collection were cloned open-ended (without a stop codon).

Proper citation: RRID:Addgene_39723 Copy   

    • RRID:Addgene_39729

http://www.addgene.org/39729

Species: Drosophila melanogaster
Genetic Insert: CG1864
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22037703
Comments: Please note that the ORFs in this collection were cloned open-ended (without a stop codon).

Proper citation: RRID:Addgene_39729 Copy   

    • RRID:Addgene_39717

http://www.addgene.org/39717

Species: Drosophila melanogaster
Genetic Insert: CG5034
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22037703
Comments: Please note that the ORFs in this collection were cloned open-ended (without a stop codon).

Proper citation: RRID:Addgene_39717 Copy   

    • RRID:Addgene_39711

http://www.addgene.org/39711

Species: Drosophila melanogaster
Genetic Insert: CG6172
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22037703
Comments: Please note that the ORFs in this collection were cloned open-ended (without a stop codon).

Proper citation: RRID:Addgene_39711 Copy   

    • RRID:Addgene_39712

http://www.addgene.org/39712

Species: Drosophila melanogaster
Genetic Insert: CG13617
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22037703
Comments: Please note that the ORFs in this collection were cloned open-ended (without a stop codon).

Proper citation: RRID:Addgene_39712 Copy   

http://www.addgene.org/39797

Species: Drosophila melanogaster
Genetic Insert: Torso
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3000; Vector Backbone:pGEM-7Zf; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9892666
Comments: Perrimon Lab plasmid #215

Proper citation: RRID:Addgene_39797 Copy   

    • RRID:Addgene_39719

http://www.addgene.org/39719

Species: Drosophila melanogaster
Genetic Insert: CG18023
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22037703
Comments: Please note that the ORFs in this collection were cloned open-ended (without a stop codon).

Proper citation: RRID:Addgene_39719 Copy   

    • RRID:Addgene_39718

http://www.addgene.org/39718

Species: Drosophila melanogaster
Genetic Insert: CG8643
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22037703
Comments: Please note that the ORFs in this collection were cloned open-ended (without a stop codon).

Proper citation: RRID:Addgene_39718 Copy   

    • RRID:Addgene_39704

http://www.addgene.org/39704

Species: Drosophila melanogaster
Genetic Insert: CG6794
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22037703
Comments: Please note that the ORFs in this collection were cloned open-ended (without a stop codon).

Proper citation: RRID:Addgene_39704 Copy   

    • RRID:Addgene_39709

http://www.addgene.org/39709

Species: Drosophila melanogaster
Genetic Insert: CG10571
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22037703
Comments: Please note that the ORFs in this collection were cloned open-ended (without a stop codon).

Proper citation: RRID:Addgene_39709 Copy   

http://www.addgene.org/39810

Species: Drosophila melanogaster
Genetic Insert: Torso genomic DNA fragment
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2464; Vector Backbone:pSP73; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9892666
Comments: Perrimon Lab plasmid #228

Proper citation: RRID:Addgene_39810 Copy   

    • RRID:Addgene_40851

http://www.addgene.org/40851

Species: Drosophila melanogaster
Genetic Insert: let-7–mm14-21
Vector Backbone Description: Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20558712
Comments: The let-7 mm14-21 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos: s: CTAGATAGTCCGTACCTACTACCTCAT as: CTAGATGAGGTAGTAGGTACGGACTAT

Proper citation: RRID:Addgene_40851 Copy   

    • RRID:Addgene_40850

http://www.addgene.org/40850

Species: Drosophila melanogaster
Genetic Insert: let-7–mm15-21
Vector Backbone Description: Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20558712
Comments: The let-7 mm15-21 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos: s: CTAGATAACCCGAACCTACTACCTCAT as: CTAGATGAGGTAGTAGGTTCGGGTTAT

Proper citation: RRID:Addgene_40850 Copy   

    • RRID:Addgene_40847

http://www.addgene.org/40847

Species: Drosophila melanogaster
Genetic Insert: let-7–mm1-8
Vector Backbone Description: Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20558712
Comments: The let-7 mm1-8 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos: s: CTAGAACTATACAACCTAGATGGAGTT as: CTAGAACTCCATCTAGGTTGTATAGTT

Proper citation: RRID:Addgene_40847 Copy   

    • RRID:Addgene_40846

http://www.addgene.org/40846

Species: Drosophila melanogaster
Genetic Insert: let-7–bulge9-15
Vector Backbone Description: Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20558712
Comments: The let-7 bulge9-15 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos: s: CTAGAACTATAGTTGGATCTACCTCAT as: CTAGATGAGGTAGATCCAACTATAGTT

Proper citation: RRID:Addgene_40846 Copy   

    • RRID:Addgene_40845

http://www.addgene.org/40845

Species: Drosophila melanogaster
Genetic Insert: let-7–bulge 9-13
Vector Backbone Description: Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20558712
Comments: The let-7 bulge 9-13 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos: s: CTAGAACTATACATGGATCTACCTCAT as: CTAGATGAGGTAGATCCATGTATAGTT

Proper citation: RRID:Addgene_40845 Copy   

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

Join the Whole Person Physiome 1st Data Jamboree on August 24-25

Join Dr. Chen Li for a Knowledge Portal Network Webinar on the dkNET Computational Core on August 6

Join NIH ODSS Data Sharing and Reuse Seminar "PanKbase: An Open, FAIR Knowledge Base of the Human Pancreas to Accelerate Diabetes Research"

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch