Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:drosophila melanogaster (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

443,797 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
KHBD00691
 
Resource Report
Resource Website 		RRID:Addgene_39731 CG14441 Drosophila melanogaster Kanamycin PMID:22037703 Please note that the ORFs in this collection were cloned open-ended (without a stop codon). Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:14:31 0
KHBD00681
 
Resource Report
Resource Website 		RRID:Addgene_39726 CG14513 Drosophila melanogaster Kanamycin PMID:22037703 Please note that the ORFs in this collection were cloned open-ended (without a stop codon). Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:14:31 0
KHBD00682
 
Resource Report
Resource Website 		RRID:Addgene_39727 CG12075 Drosophila melanogaster Kanamycin PMID:22037703 Please note that the ORFs in this collection were cloned open-ended (without a stop codon). Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:14:31 0
KHBD00671
 
Resource Report
Resource Website 		RRID:Addgene_39722 CG6312 Drosophila melanogaster Kanamycin PMID:22037703 Please note that the ORFs in this collection were cloned open-ended (without a stop codon). Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:14:31 0
KHBD00675
 
Resource Report
Resource Website 		RRID:Addgene_39723 CG6883 Drosophila melanogaster Kanamycin PMID:22037703 Please note that the ORFs in this collection were cloned open-ended (without a stop codon). Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:14:31 0
KHBD00686
 
Resource Report
Resource Website 		RRID:Addgene_39729 CG1864 Drosophila melanogaster Kanamycin PMID:22037703 Please note that the ORFs in this collection were cloned open-ended (without a stop codon). Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:14:31 0
KHBD00662
 
Resource Report
Resource Website 		RRID:Addgene_39717 CG5034 Drosophila melanogaster Kanamycin PMID:22037703 Please note that the ORFs in this collection were cloned open-ended (without a stop codon). Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:14:31 0
KHBD00649
 
Resource Report
Resource Website 		RRID:Addgene_39711 CG6172 Drosophila melanogaster Kanamycin PMID:22037703 Please note that the ORFs in this collection were cloned open-ended (without a stop codon). Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:14:31 0
KHBD00651
 
Resource Report
Resource Website 		RRID:Addgene_39712 CG13617 Drosophila melanogaster Kanamycin PMID:22037703 Please note that the ORFs in this collection were cloned open-ended (without a stop codon). Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:14:31 0
Torso cDNA Y918F in pGEM
 
Resource Report
Resource Website 		RRID:Addgene_39797 Torso Drosophila melanogaster Ampicillin PMID:9892666 Perrimon Lab plasmid #215 Backbone Marker:Promega; Backbone Size:3000; Vector Backbone:pGEM-7Zf; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Y918F 2026-08-15 01:14:31 0
KHBD00664
 
Resource Report
Resource Website 		RRID:Addgene_39719 CG18023 Drosophila melanogaster Kanamycin PMID:22037703 Please note that the ORFs in this collection were cloned open-ended (without a stop codon). Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:14:31 0
KHBD00663
 
Resource Report
Resource Website 		RRID:Addgene_39718 CG8643 Drosophila melanogaster Kanamycin PMID:22037703 Please note that the ORFs in this collection were cloned open-ended (without a stop codon). Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:14:31 0
KHBD00637
 
Resource Report
Resource Website 		RRID:Addgene_39704 CG6794 Drosophila melanogaster Kanamycin PMID:22037703 Please note that the ORFs in this collection were cloned open-ended (without a stop codon). Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:14:31 0
KHBD00647
 
Resource Report
Resource Website 		RRID:Addgene_39709 CG10571 Drosophila melanogaster Kanamycin PMID:22037703 Please note that the ORFs in this collection were cloned open-ended (without a stop codon). Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:14:31 0
Torso 11.5 kb rescue fragment
 
Resource Report
Resource Website 		RRID:Addgene_39810 Torso genomic DNA fragment Drosophila melanogaster Ampicillin PMID:9892666 Perrimon Lab plasmid #228 Backbone Marker:Promega; Backbone Size:2464; Vector Backbone:pSP73; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:14:31 0
pAS-16 (mm14-21)
 
Resource Report
Resource Website 		RRID:Addgene_40851 let-7–mm14-21 Drosophila melanogaster Kanamycin PMID:20558712 The let-7 mm14-21 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos: s: CTAGATAGTCCGTACCTACTACCTCAT as: CTAGATGAGGTAGTAGGTACGGACTAT Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin 2026-08-15 01:14:39 0
pAS-15 (mm15-21)
 
Resource Report
Resource Website 		RRID:Addgene_40850 let-7–mm15-21 Drosophila melanogaster Kanamycin PMID:20558712 The let-7 mm15-21 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos: s: CTAGATAACCCGAACCTACTACCTCAT as: CTAGATGAGGTAGTAGGTTCGGGTTAT Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin 2026-08-15 01:14:39 0
pAS-12 (mm1-8)
 
Resource Report
Resource Website 		RRID:Addgene_40847 let-7–mm1-8 Drosophila melanogaster Kanamycin PMID:20558712 The let-7 mm1-8 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos: s: CTAGAACTATACAACCTAGATGGAGTT as: CTAGAACTCCATCTAGGTTGTATAGTT Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin 2026-08-15 01:14:39 0
pAS-11 (bulge 9-15)
 
Resource Report
Resource Website 		RRID:Addgene_40846 let-7–bulge9-15 Drosophila melanogaster Kanamycin PMID:20558712 The let-7 bulge9-15 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos: s: CTAGAACTATAGTTGGATCTACCTCAT as: CTAGATGAGGTAGATCCAACTATAGTT Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin 2026-08-15 01:14:39 0
pAS-10 (bulge 9-13)
 
Resource Report
Resource Website 		RRID:Addgene_40845 let-7–bulge 9-13 Drosophila melanogaster Kanamycin PMID:20558712 The let-7 bulge 9-13 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos: s: CTAGAACTATACATGGATCTACCTCAT as: CTAGATGAGGTAGATCCATGTATAGTT Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin 2026-08-15 01:14:39 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

dkNET community events and announcements in August, 2026

HIRN Funding Opportunity: SPARKS Award

Join the Whole Person Physiome 1st Data Jamboree on August 24-25

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch