Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
KHBD00691 Resource Report Resource Website |
RRID:Addgene_39731 | CG14441 | Drosophila melanogaster | Kanamycin | PMID:22037703 | Please note that the ORFs in this collection were cloned open-ended (without a stop codon). | Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:31 | 0 | |
|
KHBD00681 Resource Report Resource Website |
RRID:Addgene_39726 | CG14513 | Drosophila melanogaster | Kanamycin | PMID:22037703 | Please note that the ORFs in this collection were cloned open-ended (without a stop codon). | Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:31 | 0 | |
|
KHBD00682 Resource Report Resource Website |
RRID:Addgene_39727 | CG12075 | Drosophila melanogaster | Kanamycin | PMID:22037703 | Please note that the ORFs in this collection were cloned open-ended (without a stop codon). | Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:31 | 0 | |
|
KHBD00671 Resource Report Resource Website |
RRID:Addgene_39722 | CG6312 | Drosophila melanogaster | Kanamycin | PMID:22037703 | Please note that the ORFs in this collection were cloned open-ended (without a stop codon). | Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:31 | 0 | |
|
KHBD00675 Resource Report Resource Website |
RRID:Addgene_39723 | CG6883 | Drosophila melanogaster | Kanamycin | PMID:22037703 | Please note that the ORFs in this collection were cloned open-ended (without a stop codon). | Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:31 | 0 | |
|
KHBD00686 Resource Report Resource Website |
RRID:Addgene_39729 | CG1864 | Drosophila melanogaster | Kanamycin | PMID:22037703 | Please note that the ORFs in this collection were cloned open-ended (without a stop codon). | Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:31 | 0 | |
|
KHBD00662 Resource Report Resource Website |
RRID:Addgene_39717 | CG5034 | Drosophila melanogaster | Kanamycin | PMID:22037703 | Please note that the ORFs in this collection were cloned open-ended (without a stop codon). | Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:31 | 0 | |
|
KHBD00649 Resource Report Resource Website |
RRID:Addgene_39711 | CG6172 | Drosophila melanogaster | Kanamycin | PMID:22037703 | Please note that the ORFs in this collection were cloned open-ended (without a stop codon). | Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:31 | 0 | |
|
KHBD00651 Resource Report Resource Website |
RRID:Addgene_39712 | CG13617 | Drosophila melanogaster | Kanamycin | PMID:22037703 | Please note that the ORFs in this collection were cloned open-ended (without a stop codon). | Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:31 | 0 | |
|
Torso cDNA Y918F in pGEM Resource Report Resource Website |
RRID:Addgene_39797 | Torso | Drosophila melanogaster | Ampicillin | PMID:9892666 | Perrimon Lab plasmid #215 | Backbone Marker:Promega; Backbone Size:3000; Vector Backbone:pGEM-7Zf; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Y918F | 2026-08-15 01:14:31 | 0 |
|
KHBD00664 Resource Report Resource Website |
RRID:Addgene_39719 | CG18023 | Drosophila melanogaster | Kanamycin | PMID:22037703 | Please note that the ORFs in this collection were cloned open-ended (without a stop codon). | Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:31 | 0 | |
|
KHBD00663 Resource Report Resource Website |
RRID:Addgene_39718 | CG8643 | Drosophila melanogaster | Kanamycin | PMID:22037703 | Please note that the ORFs in this collection were cloned open-ended (without a stop codon). | Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:31 | 0 | |
|
KHBD00637 Resource Report Resource Website |
RRID:Addgene_39704 | CG6794 | Drosophila melanogaster | Kanamycin | PMID:22037703 | Please note that the ORFs in this collection were cloned open-ended (without a stop codon). | Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:31 | 0 | |
|
KHBD00647 Resource Report Resource Website |
RRID:Addgene_39709 | CG10571 | Drosophila melanogaster | Kanamycin | PMID:22037703 | Please note that the ORFs in this collection were cloned open-ended (without a stop codon). | Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:31 | 0 | |
|
Torso 11.5 kb rescue fragment Resource Report Resource Website |
RRID:Addgene_39810 | Torso genomic DNA fragment | Drosophila melanogaster | Ampicillin | PMID:9892666 | Perrimon Lab plasmid #228 | Backbone Marker:Promega; Backbone Size:2464; Vector Backbone:pSP73; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:31 | 0 | |
|
pAS-16 (mm14-21) Resource Report Resource Website |
RRID:Addgene_40851 | let-7–mm14-21 | Drosophila melanogaster | Kanamycin | PMID:20558712 | The let-7 mm14-21 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos: s: CTAGATAGTCCGTACCTACTACCTCAT as: CTAGATGAGGTAGTAGGTACGGACTAT | Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:39 | 0 | |
|
pAS-15 (mm15-21) Resource Report Resource Website |
RRID:Addgene_40850 | let-7–mm15-21 | Drosophila melanogaster | Kanamycin | PMID:20558712 | The let-7 mm15-21 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos: s: CTAGATAACCCGAACCTACTACCTCAT as: CTAGATGAGGTAGTAGGTTCGGGTTAT | Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:39 | 0 | |
|
pAS-12 (mm1-8) Resource Report Resource Website |
RRID:Addgene_40847 | let-7–mm1-8 | Drosophila melanogaster | Kanamycin | PMID:20558712 | The let-7 mm1-8 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos: s: CTAGAACTATACAACCTAGATGGAGTT as: CTAGAACTCCATCTAGGTTGTATAGTT | Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:39 | 0 | |
|
pAS-11 (bulge 9-15) Resource Report Resource Website |
RRID:Addgene_40846 | let-7–bulge9-15 | Drosophila melanogaster | Kanamycin | PMID:20558712 | The let-7 bulge9-15 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos: s: CTAGAACTATAGTTGGATCTACCTCAT as: CTAGATGAGGTAGATCCAACTATAGTT | Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:39 | 0 | |
|
pAS-10 (bulge 9-13) Resource Report Resource Website |
RRID:Addgene_40845 | let-7–bulge 9-13 | Drosophila melanogaster | Kanamycin | PMID:20558712 | The let-7 bulge 9-13 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos: s: CTAGAACTATACATGGATCTACCTCAT as: CTAGATGAGGTAGATCCATGTATAGTT | Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:39 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.