Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Vector Backbone:lvl1 [backbone]; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25378321
Comments: lvl 1 Pos S1S2 This plasmid is slightly modified from the version used in Duportet et al. 2014, but does not have any functional differences.
Proper citation: RRID:Addgene_229194 Copy
Species: Homo sapiens
Genetic Insert: inert
Vector Backbone Description: Vector Backbone: lvl0-3 [backbone]; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:25378321
Comments: This plasmid is slightly modified from the version used in Duportet et al. 2014, but does not have any functional differences.
Proper citation: RRID:Addgene_229190 Copy
Species: Homo sapiens
Genetic Insert: TK2
Vector Backbone Description: Vector Backbone:pLJC2; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39365851
Comments: Please visit https://doi.org/10.1101/2023.06.04.543621 for bioRxiv preprint.
Proper citation: RRID:Addgene_217427 Copy
Species: Danio rerio
Genetic Insert: dgat2
Vector Backbone Description: Backbone Marker:Invitrogen ; Backbone Size:4672; Vector Backbone:pDONR-221; Vector Types:Gateway cloning middle entry; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39510175
Proper citation: RRID:Addgene_232142 Copy
Species: Synthetic
Genetic Insert: SYFP2
Vector Backbone Description: Vector Backbone:rAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40403729
Comments: Allen Institute plasmid alias: CN2317
Proper citation: RRID:Addgene_229884 Copy
Species: Synthetic
Genetic Insert: RMacL3-04.EGFP.BCB1
Vector Backbone Description: Vector Backbone:pEMS2115 (Addgene Plasmid #49140); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40403706
Comments: Please visit https://doi.org/10.1101/2024.12.01.626253 for bioRxiv preprint.
Proper citation: RRID:Addgene_225688 Copy
Species: Synthetic
Genetic Insert: RMacL3-03.EGFP.BCA12
Vector Backbone Description: Vector Backbone:pEMS2115 (Addgene Plasmid #49140); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40403706
Comments: Please visit https://doi.org/10.1101/2024.12.01.626253 for bioRxiv preprint.
Proper citation: RRID:Addgene_225687 Copy
Species: S. pyogenes (Cas9) and E. coli (Ec86 RT)
Genetic Insert: SpCas9 and Ec86 reverse transcriptase
Vector Backbone Description: Backbone Marker:John McCusker; Vector Backbone:pAG26 (Addgene Plasmid # 35127); Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40758833
Comments: SpCas9 and Ec86 RT were cloned into pAG26 using PfoI (5') and Mph1103I (3') sites (not destroyed during cloning), and HphMX marker was swapped for KanMX . Please visit https://doi.org/10.1101/2024.08.06.606807 for bioRxiv preprint.
Proper citation: RRID:Addgene_232092 Copy
Species: Synthetic
Genetic Insert: Z3 promoter and Z3EV transcription factor
Vector Backbone Description: Vector Backbone:pCas9-EcRT-GAL-Kan; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40758833
Comments: The GAL1-GAL10 promoter driving expression of SpCas9 and Ec86 RT in pCas9-EcRT-GAL-Kan was swapped with an estradiol-inducible Z3 promoter and the Z3EV transcription factor was inserterted into the Mph1103I site. Please visit https://doi.org/10.1101/2024.08.06.606807 for bioRxiv preprint.
Proper citation: RRID:Addgene_232096 Copy
Species: Danio rerio
Genetic Insert: mogat3b
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3900; Vector Backbone:pCRII-TOPO; Vector Types:in vitro transcription; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:39510175
Proper citation: RRID:Addgene_232136 Copy
Species: Danio rerio
Genetic Insert: dgat2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3900; Vector Backbone:pCRII-TOPO; Vector Types:in vitro transcription; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:39510175
Proper citation: RRID:Addgene_232134 Copy
Species: Homo sapiens
Genetic Insert: SEC24C (S107F)
Vector Backbone Description: Backbone Size:7594; Vector Backbone:pMVP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39933900
Comments: SEC24C cDNA synthesized by TWIST Bioscience; closed, PAM mutation (silent mutations of G67 (GGG>GGA) and A115 (GCC>GCA)) and therefore resistant to sgSEC24C #1 (AAGAGCCCCACCTTCCTCGG) and #2 (CTGTGGGCAACCAGCCACCT))
Proper citation: RRID:Addgene_231561 Copy
Species: Danio rerio
Genetic Insert: dgat1a
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3900; Vector Backbone:pCRII-TOPO; Vector Types:in vitro transcription; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:39510175
Proper citation: RRID:Addgene_232137 Copy
Species: Mus musculus
Genetic Insert: SPO11-EA
Vector Backbone Description: Backbone Marker:Thermo Fisher; Vector Backbone:pCDNA3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39605552
Comments: Please visit https://doi.org/10.1101/2024.11.20.624382 for bioRxiv preprint.
Proper citation: RRID:Addgene_231757 Copy
Vector Backbone Description: Vector Backbone: lvl0-G [backbone]; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:25378321
Comments: This plasmid is slightly modified from the version used in Duportet et al. 2014, but does not have any functional differences.
Proper citation: RRID:Addgene_229156 Copy
Vector Backbone Description: Vector Backbone: lvl0-5 [backbone]; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:25378321
Comments: This plasmid is slightly modified from the version used in Duportet et al. 2014, but does not have any functional differences.
Proper citation: RRID:Addgene_229155 Copy
Vector Backbone Description: Vector Backbone: lvl0-T [backbone]; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:25378321
Comments: This plasmid is slightly modified from the version used in Duportet et al. 2014, but does not have any functional differences.
Proper citation: RRID:Addgene_229158 Copy
Vector Backbone Description: Backbone Size:2679; Vector Backbone:pLS404; Vector Types:Bacterial Expression, Yeast Expression, Integrating; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2024.11.05.622133 for bioRxiv preprint.
Proper citation: RRID:Addgene_231076 Copy
Vector Backbone Description: Backbone Size:2677; Vector Backbone:pLS403; Vector Types:Bacterial Expression, Yeast Expression, Integrating; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2024.11.05.622133 for bioRxiv preprint.
Proper citation: RRID:Addgene_231075 Copy
Species: Homo sapiens
Genetic Insert: hUBC
Vector Backbone Description: Vector Backbone: lvl0-P [backbone]; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:25378321
Comments: This plasmid is slightly modified from the version used in Duportet et al. 2014, but does not have any functional differences.
Proper citation: RRID:Addgene_229164 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
