SYSTEM UPDATE: We will be performing system maintenace Saturday September 26 at 9pm to midnight Pacific Time

Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 23 showing 441 ~ 460 out of 32,424 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_104372

    This resource has 1+ mentions.

http://www.addgene.org/104372

Genetic Insert: dCas9
Vector Backbone Description: Backbone Marker:Zhang Lab; Vector Backbone:dcas9-vp64; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29224777
Comments: Based on dCas9-VP64 vector from Zhang Lab

Proper citation: RRID:Addgene_104372 Copy   


  • RRID:Addgene_104480

    This resource has 10+ mentions.

http://www.addgene.org/104480

Species: Homo sapiens
Genetic Insert: TDP-43
Vector Backbone Description: Vector Backbone:pJ4M; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29438978

Proper citation: RRID:Addgene_104480 Copy   


  • RRID:Addgene_104355

    This resource has 1+ mentions.

http://www.addgene.org/104355

Species: Homo sapiens
Genetic Insert: Human integrin b2 with tension sensor
Vector Backbone Description: Backbone Size:5596; Vector Backbone:pcDNA3.1/Hygro(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27721490

Proper citation: RRID:Addgene_104355 Copy   


  • RRID:Addgene_104561

    This resource has 1+ mentions.

http://www.addgene.org/104561

Species: Mus musculus
Genetic Insert: Ran
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24908396

Proper citation: RRID:Addgene_104561 Copy   


http://www.addgene.org/104615

Species: Synthetic
Genetic Insert: 3xVAS4
Vector Backbone Description: Backbone Marker:Gerald Rubin; Backbone Size:8358; Vector Backbone:pJFRC81 (Plasmid #36432); Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29162808

Proper citation: RRID:Addgene_104615 Copy   


  • RRID:Addgene_104543

    This resource has 1+ mentions.

http://www.addgene.org/104543

Species: Synthetic
Genetic Insert: Tet-On 3G
Vector Backbone Description: Vector Backbone:PiggyBac; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29320761

Proper citation: RRID:Addgene_104543 Copy   


  • RRID:Addgene_104542

    This resource has 1+ mentions.

http://www.addgene.org/104542

Species: Homo sapiens
Genetic Insert: MYCN proto-oncogene, bHLH transcription factor
Vector Backbone Description: Vector Backbone:PiggyBac; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29320761

Proper citation: RRID:Addgene_104542 Copy   


  • RRID:Addgene_104547

    This resource has 1+ mentions.

http://www.addgene.org/104547

Species: Arabidopsis thaliana
Genetic Insert: Cry2-mCherry-PKA W196R/F327A
Vector Backbone Description: Backbone Marker:Chandra Tucker; Backbone Size:6219; Vector Backbone:pmCherryCry2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29104065

Proper citation: RRID:Addgene_104547 Copy   


  • RRID:Addgene_104546

    This resource has 1+ mentions.

http://www.addgene.org/104546

Species: Arabidopsis thaliana
Genetic Insert: Cry2-mCherry-PKA W196R/Y204A
Vector Backbone Description: Backbone Marker:Chandra Tucker; Backbone Size:6219; Vector Backbone:pmCherryCry2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29104065

Proper citation: RRID:Addgene_104546 Copy   


http://www.addgene.org/104491

Species: Rattus norvegicus
Genetic Insert: jGCaMP7s
Vector Backbone Description: Backbone Marker:Scott Sternson; Backbone Size:4894; Vector Backbone:AAV-Syn-FLEX; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31209382
Comments: Please visit https://www.biorxiv.org/content/10.1101/434589v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_104491 Copy   


  • RRID:Addgene_104488

    This resource has 50+ mentions.

http://www.addgene.org/104488

Species: Rattus norvegicus
Genetic Insert: jGCaMP7f
Vector Backbone Description: Backbone Size:4579; Vector Backbone:AAV-Syn; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31209382
Comments: Please visit https://www.biorxiv.org/content/10.1101/434589v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_104488 Copy   


  • RRID:Addgene_104487

    This resource has 10+ mentions.

http://www.addgene.org/104487

Species: Rattus norvegicus
Genetic Insert: jGCaMP7s
Vector Backbone Description: Backbone Size:4579; Vector Backbone:AAV-Syn; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31209382
Comments: Please visit https://www.biorxiv.org/content/10.1101/434589v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_104487 Copy   


http://www.addgene.org/104496

Species: Rattus norvegicus
Genetic Insert: jGCaMP7f
Vector Backbone Description: Backbone Marker:Scott Sternson; Backbone Size:5027; Vector Backbone:AAV-CAG-FLEX; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31209382
Comments: Please visit https://www.biorxiv.org/content/10.1101/434589v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_104496 Copy   


http://www.addgene.org/104493

Species: Rattus norvegicus
Genetic Insert: jGCaMP7b
Vector Backbone Description: Backbone Marker:Scott Sternson; Backbone Size:4894; Vector Backbone:AAV-Syn-FLEX; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31209382
Comments: Please visit https://www.biorxiv.org/content/10.1101/434589v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_104493 Copy   


  • RRID:Addgene_104536

    This resource has 1+ mentions.

http://www.addgene.org/104536

Vector Backbone Description: Backbone Marker:Systems Biosciences; Backbone Size:4700; Vector Backbone:Piggybac; Vector Types:Mammalian Expression, Mouse Targeting, CRISPR, Synthetic Biology, Piggybac transposon; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30093604

Proper citation: RRID:Addgene_104536 Copy   


  • RRID:Addgene_104590

    This resource has 1+ mentions.

http://www.addgene.org/104590

Species: HIV-1 virus
Genetic Insert: 2LTR circle junction of HIV-1
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3001; Vector Backbone:pGemT; Vector Types:cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18762215
Comments: During HIV-1 infection, unintegrated viral cDNA may be circularized. The circularization generates a unique junction between the long terminal repeat (LTR) ends. HIV-1 2LTR circles have been quantified as measure of viral replication or entry of the viral cDNA into the host cell nucleus. The amplicon is 2672-2879 in the Addgene sequence file. This corresponds to HIV-1 strain HXB2 reference genome 9585-9719 bp (Addgene 2672-2806 bp) fused to 1 to 51 bp (Addgene 2829-2879 bp). In this plasmid there are 22 bp (Addgene 2807-2828 bp) of random sequence inserted between the HIV-1 ends. The insert may be amplified with primers MH535 (5' AACTAGGGAACCCACTGCTTAAG), MH536 (5' TCCACAGATCAAGGATATCTTGTC), and Taqman probe MH603 (5' ACACTACTTGAAGCACTCAAGGCAAGCTTT).

Proper citation: RRID:Addgene_104590 Copy   


  • RRID:Addgene_104583

    This resource has 1+ mentions.

http://www.addgene.org/104583

Species: Homo sapiens
Genetic Insert: Human IgG1 CH1/CH2/CH3
Vector Backbone Description: Backbone Marker:Invitrogen (Thermo Fisher); Backbone Size:10143; Vector Backbone:pCEP4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30196504
Comments: Addgene NGS results found A169G, A261G, A292G, and A295G within the EBNA1 translation on the pCEP4 backbone compared to YP_401677.1

Proper citation: RRID:Addgene_104583 Copy   


  • RRID:Addgene_104589

    This resource has 1+ mentions.

http://www.addgene.org/104589

Species: Mus musculus
Genetic Insert: calcium/calmodulin-dependent protein kinase II alpha
Vector Backbone Description: Backbone Size:2905; Vector Backbone:PX551; Vector Types:Mouse Targeting, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29056297

Proper citation: RRID:Addgene_104589 Copy   


  • RRID:Addgene_104588

    This resource has 1+ mentions.

http://www.addgene.org/104588

Species: Synthetic
Genetic Insert: Streptococcus pyogenes Cas9
Vector Backbone Description: Backbone Marker:Addgene #60957; Backbone Size:2905; Vector Backbone:PX551; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29056297

Proper citation: RRID:Addgene_104588 Copy   


http://www.addgene.org/104846

Species: Synthetic
Genetic Insert: beta-arrestin2-HA-TEV219
Vector Backbone Description: Vector Backbone:pLX208; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29189201

Proper citation: RRID:Addgene_104846 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X