Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG
Vector Backbone Description: Vector Backbone:pZE41 backbone (specR), fadD, tesA'; Vector Types:; Bacterial Resistance:Spectinomycin
Comments: strain contains pZE41 backbone (specR), fadD, tesA'
galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG
Proper citation: RRID:Addgene_48909 Copy
Genetic Insert: galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG
Vector Backbone Description: Vector Backbone:pZE41 backbone (specR), fadD, tesA'; Vector Types:; Bacterial Resistance:Spectinomycin
Comments: strain contains pZE41 backbone (specR), fadD, tesA'
galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG
Proper citation: RRID:Addgene_48900 Copy
Genetic Insert: sodA LuxR
Vector Backbone Description: Vector Backbone:pZ vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:22178928
Proper citation: RRID:Addgene_48890 Copy
Genetic Insert: galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG
Vector Backbone Description: Vector Backbone:pZE41 backbone (specR), fadD, tesA'; Vector Types:; Bacterial Resistance:Spectinomycin
Comments: strain contains pZE41 backbone (specR), fadD, tesA'
galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG
Proper citation: RRID:Addgene_48924 Copy
Genetic Insert: galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG
Vector Backbone Description: Vector Backbone:pZE41 backbone (specR), fadD, tesA'; Vector Types:; Bacterial Resistance:Spectinomycin
Comments: strain contains pZE41 backbone (specR), fadD, tesA'
galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG
Proper citation: RRID:Addgene_48923 Copy
Genetic Insert: ndhII and LuxR
Vector Backbone Description: Vector Backbone:pZ vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:22178928
Proper citation: RRID:Addgene_48889 Copy
Genetic Insert: galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG
Vector Backbone Description: Vector Backbone:pZE41 backbone (specR), fadD, tesA'; Vector Types:; Bacterial Resistance:Spectinomycin
Comments: strain contains pZE41 backbone (specR), fadD, tesA'
galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG
Proper citation: RRID:Addgene_48922 Copy
Genetic Insert: galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG
Vector Backbone Description: Vector Backbone:pZE41 backbone (specR), fadD, tesA'; Vector Types:; Bacterial Resistance:Spectinomycin
Comments: strain contains pZE41 backbone (specR), fadD, tesA'
galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG
Proper citation: RRID:Addgene_48921 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2734; Vector Backbone:pCR8GWTOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23979020
Comments: Clone sgRNA spacer into BbsI site. Sequence using LKO5' primer: GACTATCATATGCTTACCGT
This vector can be transfected, or transferred to a gateway destination vector ( http://www.lifetechnologies.com/us/en/home/life-science/cloning/gateway-cloning/gateway-destination-vectors.html ), or the U6-sgRNA-terminator fragment can be PCR-amplified and transfected as linear DNA. Another template for such linear DNA is one of the dual expression vectors:
http://www.addgene.org/48240/
http://www.addgene.org/48239/
http://www.addgene.org/48238/
http://www.addgene.org/48236/
For more information including protocols and
updates, please go to http://www.crispr-on.org
Proper citation: RRID:Addgene_49045 Copy
Genetic Insert: galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG
Vector Backbone Description: Vector Backbone:pZE41 backbone (specR), fadD, tesA',fadR; Vector Types:; Bacterial Resistance:Spectinomycin
Comments: galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG
fadE- fadR->CAT, plTet0-> (tesA and fadD), fadR overexpression
Proper citation: RRID:Addgene_48939 Copy
Genetic Insert: galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG
Vector Backbone Description: Vector Backbone:pZE41 backbone (specR), fadD, tesA'; Vector Types:; Bacterial Resistance:Spectinomycin
Comments: galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG
fadE- fadR->CAT, plTet0-> (tesA and fadD)
Proper citation: RRID:Addgene_48938 Copy
Genetic Insert: galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG
Vector Backbone Description: Vector Backbone:pZE41 backbone (specR), fadD, tesA'; Vector Types:; Bacterial Resistance:Spectinomycin
Comments: strain contains pZE41 backbone (specR), fadD, tesA'
galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG
Proper citation: RRID:Addgene_48930 Copy
Genetic Insert: galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG
Vector Backbone Description: Vector Backbone:pZE41 backbone (specR), fadD, tesA'; Vector Types:; Bacterial Resistance:Spectinomycin
Comments: strain contains pZE41 backbone (specR), fadD, tesA'
galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG
Proper citation: RRID:Addgene_48934 Copy
Genetic Insert: galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG
Vector Backbone Description: Vector Backbone:pZE41 backbone (specR), fadD, tesA'; Vector Types:; Bacterial Resistance:Spectinomycin
Comments: strain contains pZE41 backbone (specR), fadD, tesA'
galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG
Proper citation: RRID:Addgene_48933 Copy
Genetic Insert: galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG
Vector Backbone Description: Vector Backbone:pZE41 backbone (specR), fadD, tesA'; Vector Types:; Bacterial Resistance:Spectinomycin
Comments: strain contains pZE41 backbone (specR), fadD, tesA'
galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG
Proper citation: RRID:Addgene_48928 Copy
Genetic Insert: galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG
Vector Backbone Description: Vector Backbone:pZE41 backbone (specR), fadD, tesA'; Vector Types:; Bacterial Resistance:Spectinomycin
Comments: strain contains pZE41 backbone (specR), fadD, tesA'
galK::fadBp-CAT, mutS::bla, fadE265G>T/268delG
Proper citation: RRID:Addgene_48927 Copy
Species: Beta vulgaris
Genetic Insert: BvCYP76AD1
Vector Backbone Description: Backbone Marker:Sylvestre Marillonnet; Vector Backbone:pICH41308; Vector Types:Synthetic Biology, MoClo Cloning Vector; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:34177999
Proper citation: RRID:Addgene_169084 Copy
Species: Beta vulgaris
Genetic Insert: BvADHα
Vector Backbone Description: Backbone Marker:Sylvestre Marillonnet; Vector Backbone:pICH41308; Vector Types:Synthetic Biology, MoClo Cloning Vector; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:34177999
Proper citation: RRID:Addgene_169087 Copy
Species: Synthetic
Genetic Insert: iLight
Vector Backbone Description: Backbone Marker:Y. Yang lab (East China University of Science and Technology, China), https://pubmed.ncbi.nlm.nih.gov/27311594/; Backbone Size:5347; Vector Backbone:pLEVI(408)-ColE; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:34162879
Proper citation: RRID:Addgene_170268 Copy
Species: Synthetic
Genetic Insert: M.XbaI
Vector Backbone Description: Backbone Marker:EMD Millipore/Novagen; Backbone Size:1724; Vector Backbone:pACYC; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:35255734
Proper citation: RRID:Addgene_170767 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.