Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: MAP-MBD
Vector Backbone Description: Vector Backbone:pK7m34GW; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:25329881
Proper citation: RRID:Addgene_61197 Copy
Species: Synthetic
Genetic Insert: REX-GECO1
Vector Backbone Description: Backbone Size:4560; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25358432
Comments: The construct is numbered based on GCaMP.
There are 2 mismatches between Addgene's sequence and the provided reference sequence. These should not affect plasmid function.
Proper citation: RRID:Addgene_61248 Copy
Species: Synthetic
Genetic Insert: REX-GECO0.9
Vector Backbone Description: Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25358432
Comments: The construct is numbered based on GCaMP.
Proper citation: RRID:Addgene_61247 Copy
Species: Synthetic
Genetic Insert: REX-GECO0.9
Vector Backbone Description: Backbone Size:4560; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25358432
Comments: The construct is numbered based on GCaMP.
There are 2 mismatches between Addgene's sequence and the provided reference sequence. These should not affect plasmid function.
Proper citation: RRID:Addgene_61249 Copy
Species: Synthetic
Genetic Insert: LAR-GECO1
Vector Backbone Description: Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25164254
Comments: The construct is numbered based on GCaMP.
Proper citation: RRID:Addgene_61244 Copy
Species: Homo sapiens
Genetic Insert: LKB1
Vector Backbone Description: Backbone Marker:Eric Campeau; Vector Backbone:pENTR/pTER+; Vector Types:ENTR clone; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25042806
Proper citation: RRID:Addgene_61243 Copy
Species: Homo sapiens
Genetic Insert: LKB1
Vector Backbone Description: Backbone Marker:Eric Campeau; Vector Backbone:pLentiX2-PURO; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25042806
Proper citation: RRID:Addgene_61242 Copy
Species: Synthetic
Genetic Insert: 2xTY1-V5
Vector Backbone Description: Backbone Marker:Hugo J Bellen; Backbone Size:3300; Vector Backbone:pBS-KS-attB1-2-PT-SA-SD; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25324299
Proper citation: RRID:Addgene_61257 Copy
Species: Synthetic
Genetic Insert: 2xTY1-V5
Vector Backbone Description: Backbone Marker:Hugo J Bellen; Backbone Size:3300; Vector Backbone:pBS-KS-attB1-2-PT-SA-SD; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25324299
Proper citation: RRID:Addgene_61256 Copy
Species: Synthetic
Genetic Insert: sgRNA(F+E)
Vector Backbone Description: Backbone Marker:Goldstein lab; Backbone Size:8113; Vector Backbone:pDD162; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25491644
Comments: target sequence: ggatggatgtgtagtcaatt
Proper citation: RRID:Addgene_61250 Copy
Species: Caenorhabditis elegans
Genetic Insert: U6 promoter
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3519; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:CRISPR, Cloning template; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25491644
Proper citation: RRID:Addgene_61253 Copy
Vector Backbone Description: Backbone Marker:Chris Marx; Backbone Size:6878; Vector Backbone:pCM62; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Tetracycline
Defining Citation: PMID:25262659
Proper citation: RRID:Addgene_61303 Copy
Species: E.coli
Genetic Insert: E. coli lipoic acid ligase
Vector Backbone Description: Backbone Size:5190; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25313043
Proper citation: RRID:Addgene_61307 Copy
Species: Synthetic
Genetic Insert: GAL4_DBD::QF2w_AD
Vector Backbone Description: Vector Backbone:pCaSpeR; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.
Proper citation: RRID:Addgene_61309 Copy
Species: Bacillus megaterium
Genetic Insert: Cytochrome P450-BM3 heme domain 9D7
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pCWori; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22659321
Proper citation: RRID:Addgene_61308 Copy
Species: Nematode virus
Genetic Insert: Orsay RNA2
Vector Backbone Description: Backbone Marker:Fire Lab Vector Kit ; Backbone Size:3826; Vector Backbone:pPD49.83; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25078701
Proper citation: RRID:Addgene_61261 Copy
Genetic Insert: Ptac-dTomato
Vector Backbone Description: Vector Backbone:pAWP78; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25548049
Comments: dTomato reference:
Shaner, N. C., Campbell, R. E., Steinbach, P. A., Giepmans, B. N. G., Palmer, A. E., & Tsien, R. Y. (2004). Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nature Biotechnology, 22(12), 1567–1572. doi:10.1038/nbt1037
Proper citation: RRID:Addgene_61264 Copy
Vector Backbone Description: Backbone Size:4979; Vector Backbone:pCM66; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25548049
Comments: In order to use plasmid pAWP78, inserts should be added by Gibson Cloning. Primers to amplify the backbone have been annotated on the depositor's plasmid map. The sequences are (5' to 3'):
AP259_pAWP78_fwd1 - TTGTCGGGAAGATGCGTGAT
AP254_pAWP78_rev1 - CAGCTCACTCAAAGGCGGTA
Proper citation: RRID:Addgene_61263 Copy
Species: Synthetic
Genetic Insert: QF2w
Vector Backbone Description: Vector Backbone:pGAWB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.
Proper citation: RRID:Addgene_61313 Copy
Species: Synthetic
Genetic Insert: LexA_DBD::QF2w_AD
Vector Backbone Description: Vector Backbone:pCaSpeR; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.
Proper citation: RRID:Addgene_61311 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.