Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: anti-Nav1.4 Na+ channel (Rattus norvegicus) recombinant Mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: This is a recombinant antibody derived from RRID: AB_2921673. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_190306 Copy
Species: Mus musculus
Genetic Insert: Kv2.2 K+ channel (Rattus norvegicus) recombinant scFV
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pCDNA3.4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: This is a recombinant antibody derived from RRID: AB_2922744.
Proper citation: RRID:Addgene_190548 Copy
Species: Mus musculus
Genetic Insert: anti-Brevican (Rattus norvegicus) recombinant Mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: This is a recombinant antibody derived from RRID: AB_2921675. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_190309 Copy
Species: Mus musculus
Genetic Insert: anti-REEP1 (Mus musculus) recombinant Mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: This is a recombinant antibody derived from RRID: AB_2921680. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_190314 Copy
Species: Mus musculus
Genetic Insert: anti-Rem2 (Rattus norvegicus) recombinant Mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: This is a recombinant antibody derived from RRID: AB_2921678. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_190312 Copy
Species: Mus musculus
Genetic Insert: anti-MFF (Homo sapiens) recombinant Mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: This is a recombinant antibody derived from RRID: AB_2921684. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_190318 Copy
Species: Mus musculus
Genetic Insert: anti-Bral1 (Mus musculus) recombinant Mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: This is a recombinant antibody derived from RRID: AB_2921682. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_190316 Copy
Species: Homo sapiens
Genetic Insert: SHOC2
Vector Backbone Description: Vector Backbone:plx307; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35831509
Proper citation: RRID:Addgene_190580 Copy
Species: Mus musculus
Genetic Insert: shStk16-3
Vector Backbone Description: Backbone Size:6337; Vector Backbone:AAV.CBA.YFP.miR-E; Vector Types:AAV, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35499073
Proper citation: RRID:Addgene_180393 Copy
Species: Mus musculus
Genetic Insert: shTgm5-3
Vector Backbone Description: Backbone Size:6337; Vector Backbone:AAV.CBA.YFP.miR-E; Vector Types:AAV, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35499073
Proper citation: RRID:Addgene_180396 Copy
Species: Mus musculus
Genetic Insert: shIrak1-2
Vector Backbone Description: Backbone Size:6337; Vector Backbone:AAV.CBA.YFP.miR-E; Vector Types:AAV, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35499073
Proper citation: RRID:Addgene_180398 Copy
Vector Backbone Description: Backbone Marker:Yuejun Chen; Vector Backbone:PL652 (Plasmid #159456); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35700056
Proper citation: RRID:Addgene_191681 Copy
Species: Mus musculus
Genetic Insert: GluN2B/NR2B glutamate receptor (Rattus norvegicus) recombinant scFV
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pCDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: This is a recombinant antibody derived from RRID: AB_2922758.
Proper citation: RRID:Addgene_190563 Copy
Species: Mus musculus
Genetic Insert: TrpC5 (Homo sapiens) recombinant scFV
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pCDNA3.4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: This is a recombinant antibody derived from RRID: AB_2922759.
Proper citation: RRID:Addgene_190564 Copy
Species: Mus musculus
Genetic Insert: BKbeta2 K+ channel (Mus musculus) recombinant scFV
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pCDNA3.4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: This is a recombinant antibody derived from RRID: AB_2922756.
Proper citation: RRID:Addgene_190561 Copy
Species: E.coli
Genetic Insert: E. coli B F– ompT gal dcm lon hsdSB(rB–mB–) [malB+]K-12(λS) araB::T7RNAP-tetA Δretron-Eco1
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:34949838
Comments: Derived from BL21(AI), grow in LB in BSL1 laboratory conditions
Genotype: E. coli B F– ompT gal dcm lon hsdSB(rB–mB–) [malB+]K-12(λS) araB::T7RNAP-tetA Δretron-Eco1
Genotyping primers: CATGTGCATGAAAACCACTGC / CTGGTTGGACGAAGAAGTGC (273 base amplicon)
Proper citation: RRID:Addgene_191530 Copy
Species: Mus musculus
Genetic Insert: GluN2B/NR2B glutamate receptor (Rattus norvegicus) recombinant scFV
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pCDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: This is a recombinant antibody derived from RRID: AB_2922757.
Proper citation: RRID:Addgene_190562 Copy
Species: Varanus exanthematicus
Genetic Insert: ATP1A1
Vector Backbone Description: Backbone Marker:Thermo Fisher (Invitrogen); Backbone Size:5238; Vector Backbone:pFastBac Dual; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35972957
Comments: Please visit https://doi.org/10.1101/2021.11.29.470343 for bioRxiv preprint.
Proper citation: RRID:Addgene_187432 Copy
Species: Mus musculus
Genetic Insert: shSrpk3-2
Vector Backbone Description: Backbone Size:6337; Vector Backbone:AAV.CBA.YFP.miR-E; Vector Types:AAV, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35499073
Proper citation: RRID:Addgene_180401 Copy
Species: Mus musculus
Genetic Insert: shSrpk3-3
Vector Backbone Description: Backbone Size:6337; Vector Backbone:AAV.CBA.YFP.miR-E; Vector Types:AAV, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35499073
Proper citation: RRID:Addgene_180402 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
