Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Grap
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 38.1 kDa
Proper citation: RRID:Addgene_46434 Copy
Species: Homo sapiens
Genetic Insert: Gap/RASGAP(N)
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 38.7 kDa
Proper citation: RRID:Addgene_46432 Copy
Species: Homo sapiens
Genetic Insert: Grb10
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 45.8 kDa
Proper citation: RRID:Addgene_46436 Copy
Species: Homo sapiens
Genetic Insert: CPAP RNAi resistant mutant
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2717; Vector Backbone:pENTR 1A; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22100914
Proper citation: RRID:Addgene_46390 Copy
Species: Escherichia coli
Genetic Insert: LacI
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4092; Vector Backbone:pBADmyc-hisB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23834731
Comments: LacI expression was induced with 0.2% (w/v) L-arabinose and cells incubated for 4 h at 20 °C.
Proper citation: RRID:Addgene_46394 Copy
Species: Homo sapiens
Genetic Insert: Frk
Vector Backbone Description: Backbone Marker:Avidity; Backbone Size:4216; Vector Backbone:pAC4; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 37.1 kDa
Proper citation: RRID:Addgene_46428 Copy
Species: Homo sapiens
Genetic Insert: FynA
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 37.4 kDa
Proper citation: RRID:Addgene_46429 Copy
Species: Mus musculus
Genetic Insert: Arc
Vector Backbone Description: Vector Backbone:pBluescript; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23764283
Proper citation: RRID:Addgene_46389 Copy
Species: Homo sapiens
Genetic Insert: Eat2
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 39.6 kDa
Proper citation: RRID:Addgene_46423 Copy
Species: Homo sapiens
Genetic Insert: Cten
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 39.1 kDa
Proper citation: RRID:Addgene_46421 Copy
Species: Homo sapiens
Genetic Insert: Fgr
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 37.3 kDa
Proper citation: RRID:Addgene_46427 Copy
Species: Homo sapiens
Genetic Insert: Emt
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 38.8 kDa
Proper citation: RRID:Addgene_46424 Copy
Species: Homo sapiens
Genetic Insert: EWSR1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1(-)B/myc-His; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18320585
Comments: EWS cDNA was amplified by PCR using XhoI-NotI-forward and EcoRI-reverse primers 5-TCTCTCGAGCG
GCCGCGCCACCATGGCGTCCACGGATTACAGTACC-3
5-CCGAATTCGTAGGGCCGATCTCTGCGCTCCTG-3, respectively.
Proper citation: RRID:Addgene_46386 Copy
Species: Homo sapiens
Genetic Insert: EWSR1
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:4900; Vector Backbone:pGEX-6p-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16044463
Comments: The EWS cDNA23 was PCR-amplified using primers
ATCTGGAATTCAAATGGCGTCCACGGATTACAGTACCTATAGCCAAGCTGCAGC and CTGGTAGTCAATGCAGCTCGAGGGGGTCTCTGCATCTAGTAGG.
Proper citation: RRID:Addgene_46384 Copy
Species: Homo sapiens
Genetic Insert: Crk
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 38.9 kDa
Proper citation: RRID:Addgene_46418 Copy
Species: Thermoplasma volcanium
Genetic Insert: TvoVMA intein
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3559; Vector Backbone:pRSFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22001202
Proper citation: RRID:Addgene_46378 Copy
Species: Nostoc punctiforme
Genetic Insert: NpuDnaE intein inactive
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3559; Vector Backbone:pRSF-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19636943
Proper citation: RRID:Addgene_46379 Copy
Species: Nostoc punctiforme
Genetic Insert: NpuDnaE intein, inactive
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3559; Vector Backbone:pRSF-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23974115
Proper citation: RRID:Addgene_46376 Copy
Species: Nostoc punctiforme
Genetic Insert: NpuDnaE intein delta variant, inactive
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3559; Vector Backbone:pRSF-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23974115
Proper citation: RRID:Addgene_46377 Copy
Species: Homo sapiens
Genetic Insert: chimerin
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 36.8 kDa
Proper citation: RRID:Addgene_46415 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.