Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: E6-AP I (C21Y)
Vector Backbone Description: Backbone Size:7818; Vector Backbone:PHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30257870
Proper citation: RRID:Addgene_119304 Copy
Genetic Insert: split nLuc fused to antiparallel Coiled-coil AP10 connected with P9mS via PPV cleavable linker
Vector Backbone Description: Backbone Size:5443; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30531965
Proper citation: RRID:Addgene_119302 Copy
Genetic Insert: split cLuc connected to P9 coil via TEVs cleavable linker
Vector Backbone Description: Backbone Size:5443; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30531965
Proper citation: RRID:Addgene_119303 Copy
Species: Homo sapiens
Genetic Insert: E6-AP I (G20V)
Vector Backbone Description: Backbone Size:7818; Vector Backbone:PHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30257870
Proper citation: RRID:Addgene_119308 Copy
Species: Homo sapiens
Genetic Insert: E6-AP I (R39H)
Vector Backbone Description: Backbone Size:7818; Vector Backbone:PHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30257870
Proper citation: RRID:Addgene_119309 Copy
Genetic Insert: dcas9
Vector Backbone Description: Vector Backbone:R6Kgamma; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30617347
Proper citation: RRID:Addgene_119275 Copy
Genetic Insert: sgRNA folA (E. aerogenes)
Vector Backbone Description: Vector Backbone:R6Kgamma; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30617347
Proper citation: RRID:Addgene_119273 Copy
Species: Homo sapiens
Genetic Insert: GalT
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4733; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:8670420
Comments: The EGFP (Clontech Laboratories, Inc., Palo, Alto, CA) contains a valine immediately after the start codon that is not found in the wild type sequence. However, to avoid confusion with previously published work on GFP mutants, the wild type residue numbers are used. This construct contains amino acids 1-60 of the human galactosyltransferase. The original article describes cloning into pcDNA1 ro pCDLSRa. A subsequent paper Zaal et. al. Cell 99:589-601 (1999) describes subcloning into the parent vector used here.
Proper citation: RRID:Addgene_11929 Copy
Species: jellyfish
Genetic Insert: GFP w/ stop codon
Vector Backbone Description: Backbone Size:6016; Vector Backbone:p2UGpd; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8662547
Comments: 2 micron yeast plasmid. GPD promoter. Map of empty vector included here.
Proper citation: RRID:Addgene_1195 Copy
Genetic Insert: CD3delta-YFP
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3961; Vector Backbone:EGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16103128
Comments: CD3 delta was PCR amplified from a plasmid, introducing flanking BglII and EcoRI sites, and cloned in Ub-R-YFP digested with BamHI and EcoRI.
Proper citation: RRID:Addgene_11951 Copy
Genetic Insert: YFP-CL1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3932; Vector Backbone:EGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16103128
Comments: The YFP-CL1 reporter was generated by inserting an oligodimer encoding the 16 amino acid CL1 degradation signal (ACKNWFSSLSHFVIHL) in enhanced GFP-C1 (BD Biosciences Clontech) using the EcoRI and BamH1 restriction sites, then the enhanced GFP open-reading frame was replaced with YFP using the Nhe1 and SspB1 restriction sites.
Proper citation: RRID:Addgene_11950 Copy
Genetic Insert: Ub-M-GFP
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5830; Vector Backbone:pYES2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14644450
Comments: The ubiquitin open reading frame was amplified by PCR from the Ub-Pro-Gal plasmid with the sense primer 5'-GCG GAATTCACCATGCAGATCTTCGTGAAGACT-3' and the antisense primer 5'-GCG GGATCCTGTCGACCAAGCTTCCCXXX CCCACCTCTGAGACGGAGTAC-3' where the XXX leads to a Methionine at position 1 (see article 10802622, Figure 1). The PCR product was cloned into the EcoRI and BamHI sites of the EGFP-N1 vector from Clontech.
The Ub-M-GFP insert was then excised with EcoRI and NotI and cloned into pYES2.
Proper citation: RRID:Addgene_11952 Copy
Species: Synthetic
Genetic Insert: J23110MH
Vector Backbone Description: Backbone Size:2247; Vector Backbone:PICH41295; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:30819783
Comments: Please visit https://www.biorxiv.org/content/10.1101/426700v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_119584 Copy
Genetic Insert: Ub-G76V-GFP
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5830; Vector Backbone:pYES2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14644450
Comments: The ubiquitin open reading frame was amplified by PCR from the Ub-Pro-Gal plasmid with the sense primer 5'-GCG GAATTCACCATGCAGATCTTCGTGAAGACT-3' and the antisense primer 5'-GCGGGATCCTGTCGACCAAGCTTC
CCCACCACACCTCTGAGACGGAGTAC-3'. The PCR product was cloned into the EcoRI and BamHI sites of the EGFP-N1 vector from Clontech.
The Ub-G76V-GFP insert was then excised with EcoRI and NotI and cloned into pYES2.
Proper citation: RRID:Addgene_11954 Copy
Species: Synthetic
Genetic Insert: J23105MH
Vector Backbone Description: Backbone Size:2247; Vector Backbone:PICH41295; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:30819783
Comments: Please visit https://www.biorxiv.org/content/10.1101/426700v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_119579 Copy
Species: Synthetic
Genetic Insert: J23103MH
Vector Backbone Description: Backbone Size:2247; Vector Backbone:PICH41295; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:30819783
Comments: Please visit https://www.biorxiv.org/content/10.1101/426700v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_119578 Copy
Species: Synthetic
Genetic Insert: J23101MH
Vector Backbone Description: Backbone Size:2247; Vector Backbone:PICH41295; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:30819783
Comments: Please visit https://www.biorxiv.org/content/10.1101/426700v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_119576 Copy
Genetic Insert: Nx1BTM-FCS-ChR2ET/TC-mVenus
Vector Backbone Description: Backbone Size:5012; Vector Backbone:AAV2-CAG-MSC-WPRE(Penn); Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30343901
Proper citation: RRID:Addgene_119298 Copy
Genetic Insert: split nLuc fused to antiparallel Coiled-coil AP4 connected with P3 via TEV cleavable linker
Vector Backbone Description: Backbone Size:5443; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30531965
Proper citation: RRID:Addgene_119299 Copy
Genetic Insert: PBAD
Vector Backbone Description: Backbone Size:2247; Vector Backbone:PICH41295; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:30819783
Comments: L-arabinose inducible promoter from the arabinose operon in E. coli. Please visit https://www.biorxiv.org/content/10.1101/426700v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_119574 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
