Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: MtSYP41
Vector Backbone Description: Vector Backbone:pK7m34GW; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:25329881
Proper citation: RRID:Addgene_61176 Copy
Genetic Insert: α-actinin-stFRET
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEYFP–C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18479457
Proper citation: RRID:Addgene_61104 Copy
Species: Synthetic
Genetic Insert: eGFPbait
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCRII-TOPO; Vector Types:zebrafish expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:24179142
Comments: The eGFPbait-E2A-KalTA4 donor plasmid was generated by forward insertion of a PCR-amplified eGFP fragment into the pCRII-TOPO vector. Primers used were eGFP_fwd: ATAGTGGTACCATGGTGAGCAAGGGCGAGGAGC, and eGFP_rev: GTAGCGGCTGAAGCACTGCACGC. The E2A-KalTA4-pA fragment was generated by fusion of individual PCR products using Phusion High-Fidelity DNA Polymerase (Thermo Scientific); E2A was amplified with the primers E2A_fwd: TGCAGATATCCAGGAGGAGGACAGTGTACTAATTATGCTC, E2A_rev: TTCCTCCTCCGGGACCTGGGTTGCTC from a previously generated E2A sequence (Szymczak et al. 2004, PMID 15064769). KalTA4-pA was amplified with KalTA4_fwd: CCCAGGTCCCGGAGGAGGAAAACTGCTC, KalTA4_rev: CATGCTCGAGTCCACTAGTTCTAGAGCG, using the 4 × Kaloop vector as template (Distel et al. 2009, PMID 19628697). Subsequently, both fragments were fused, amplified, and inserted into pCRII-TOPO-eGFPbait with EcoRV and XhoI.
Proper citation: RRID:Addgene_61069 Copy
Species: Homo sapiens
Genetic Insert: LMO2
Vector Backbone Description: Backbone Size:7500; Vector Backbone:pSIN4-EF1alpha-IRES-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25019369
Proper citation: RRID:Addgene_61064 Copy
Genetic Insert: MtRAB5A2
Vector Backbone Description: Vector Backbone:pK7m34GW; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:25329881
Proper citation: RRID:Addgene_61185 Copy
Species: Homo sapiens
Genetic Insert: GATA2
Vector Backbone Description: Backbone Size:7500; Vector Backbone:pSIN4-EF1alpha-IRES-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25019369
Proper citation: RRID:Addgene_61063 Copy
Species: Homo sapiens
Genetic Insert: ETV2
Vector Backbone Description: Backbone Size:7500; Vector Backbone:pSIN4-EF1alpha-IRES-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25019369
Proper citation: RRID:Addgene_61061 Copy
Genetic Insert: MtBCPsp-mCherry
Vector Backbone Description: Vector Backbone:pKm43GW; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:25329881
Proper citation: RRID:Addgene_61182 Copy
Species: Homo sapiens
Genetic Insert: TAL1
Vector Backbone Description: Backbone Size:7500; Vector Backbone:pSIN4-EF1alpha-IRES-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25019369
Proper citation: RRID:Addgene_61065 Copy
Genetic Insert: spectrin-cpstFRET
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22389408
Proper citation: RRID:Addgene_61111 Copy
Species: Drosophila melanogaster
Genetic Insert: musashi RNA binding domain
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5456; Vector Backbone:pET22; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_61110 Copy
Species: Homo sapiens
Genetic Insert: PTPN14 PPxY mutation
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25023289
Proper citation: RRID:Addgene_61006 Copy
Species: Homo sapiens
Genetic Insert: PTPN14 delete C
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25023289
Proper citation: RRID:Addgene_61005 Copy
Species: Homo sapiens
Genetic Insert: PTPN14 delete N
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25023289
Proper citation: RRID:Addgene_61004 Copy
Species: Homo sapiens
Genetic Insert: PTPN14
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25023289
Proper citation: RRID:Addgene_61003 Copy
Species: Homo sapiens
Genetic Insert: UbcH5A
Vector Backbone Description: Backbone Marker:Novagen, modified; Backbone Size:6000; Vector Backbone:PETSUMO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23955022
Proper citation: RRID:Addgene_61081 Copy
Species: Homo sapiens
Genetic Insert: gRNA_hIRF1 promoter #12
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:8083; Vector Backbone:pSIR; Vector Types:Mammalian Expression, Retroviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25051498
Comments: gRNA target sequence: CCGGGGGCGCTGGGCTGTCCCGG
Proper citation: RRID:Addgene_61080 Copy
Species: Mus musculus
Genetic Insert: smallest constitutive BIN1excluding exon 7, 11, 13-17
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:8123; Vector Backbone:pDEST27; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24836577
Proper citation: RRID:Addgene_61086 Copy
Species: Other
Genetic Insert: Chloramphenicol acetyltransferase
Vector Backbone Description: Backbone Marker:Ambion; Vector Backbone:pAMB; Vector Types:Unspecified; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26781350
Proper citation: RRID:Addgene_61002 Copy
Species: Homo sapiens
Genetic Insert: H1 promoter; gRNA sequences
Vector Backbone Description: Backbone Size:2636; Vector Backbone:pUC19; Vector Types:Mammalian Expression, CRISPR, /Cas9 gRNA cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25209046
Comments: As Ampicillin gene and H1 promoter contain BsaI sites, we mutated the sequence of Amp gene (G1601C, not change amino acid), and mutated H1 promoter from GAGACC to GAGGACC to eliminate the BsaI internal site.
Proper citation: RRID:Addgene_61089 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
